WormBase Tree Display for Variation: WBVar00088276
expand all nodes | collapse all nodes | view schema
WBVar00088276 | Evidence | Paper_evidence | WBPaper00004727 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ks5 | |||||
Other_name | C40H5.5b.1:c.516+1G>A | ||||||
C40H5.5a.1:c.600+1G>A | |||||||
HGVSg | CHROMOSOME_X:g.11766925C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C40H5 | |||
Flanking_sequences | atttttcatcatgcgtgtttcgtatgtttt | tgagtttttaacaattttaaacaaattgtt | |||||
Mapping_target | C40H5 | ||||||
Type_of_mutation | Substitution | g | a | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00007506 | ||||||
WBStrain00052442 | |||||||
Laboratory | FK | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006654 | |||||
Transcript | C40H5.5b.1 | VEP_consequence | splice_donor_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | C40H5.5b.1:c.516+1G>A | ||||||
Intron_number | 4/8 | ||||||
C40H5.5a.1 | VEP_consequence | splice_donor_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | C40H5.5a.1:c.600+1G>A | ||||||
Intron_number | 5/10 | ||||||
Interactor | WBInteraction000003413 | ||||||
WBInteraction000003414 | |||||||
WBInteraction000003415 | |||||||
WBInteraction000003416 | |||||||
WBInteraction000503643 | |||||||
WBInteraction000521604 | |||||||
WBInteraction000554842 | |||||||
WBInteraction000554843 | |||||||
WBInteraction000554844 | |||||||
WBInteraction000569170 | |||||||
Genetics | Interpolated_map_position | X | 6.71664 | ||||
Description | Phenotype (7) | ||||||
Phenotype_not_observed | WBPhenotype:0000637 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | No obvious abnormalities in dauer formation. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000648 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | No obvious abnormalities in male mating. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000663 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | No obvious abnormalities in osmotic avoidance. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001462 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | No obvious abnormalities in chemotaxis to NaCl. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Asymmetric expression in AWC was normal | Paper_evidence | WBPaper00003760 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Reference (16) | |||||||
Remark | ks5 is mutated at the splice donor site at exon 5 (G->A) [030414 ck1] | ||||||
Method | Substitution_allele |