WormBase Tree Display for Variation: WBVar00088311
expand all nodes | collapse all nodes | view schema
WBVar00088311 | Evidence | Paper_evidence | WBPaper00002350 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ku68 | |||||||
Other_name | F13B9.5.1:c.1592G>A | ||||||||
CE25854:p.Arg531His | |||||||||
HGVSg | CHROMOSOME_X:g.8282191G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F13B9 | |||||
Flanking_sequences | tagaaacaaaattcttgtttaagaataccc | tcatgacaacattgctcttttccttggcta | |||||||
Mapping_target | F13B9 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002350 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026498 | ||||||||
WBStrain00026503 | |||||||||
Laboratory | MH | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002239 | |||||||
Transcript | F13B9.5.1 (12) | ||||||||
Interactor | WBInteraction000002327 | ||||||||
WBInteraction000524421 | |||||||||
WBInteraction000535560 | |||||||||
Genetics | Interpolated_map_position | X | -0.197266 | ||||||
Description | Phenotype_not_observed | WBPhenotype:0001060 | Paper_evidence | WBPaper00003955 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001063 | Paper_evidence | WBPaper00003955 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00003955 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002193 | Paper_evidence | WBPaper00044058 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "No allele of egl-17, egl-15 or any other downstream FGF component other than sem-5 had any effect on orientation as single mutants (Table 1), which is probably due to the involvement of sem-5 in one of the other pathways controlling vulval orientation as well as its role in the FGF pathway." | Paper_evidence | WBPaper00044058 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006895 | PATO:0000460 | Paper_evidence | WBPaper00044058 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00023380 | ||||||||
WBPaper00003955 | |||||||||
WBPaper00023691 | |||||||||
WBPaper00044058 | |||||||||
Method | Substitution_allele |