WormBase Tree Display for Variation: WBVar00088400
expand all nodes | collapse all nodes | view schema
WBVar00088400 | Evidence | Paper_evidence | WBPaper00002892 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ky51 | |||||||
Other_name | CE07832:p.Pro70Ser | ||||||||
C02C6.1a.1:c.208C>T | |||||||||
CE07833:p.Pro70Ser | |||||||||
C02C6.1b.1:c.208C>T | |||||||||
HGVSg | CHROMOSOME_X:g.15569193C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C02C6 | |||||
Flanking_sequences | ccacgtggatcaggaatcgtaacacgtcgt | cacttattttgcagcttattcaagatcgca | |||||||
Mapping_target | C02C6 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005217 | ||||||||
Laboratory | CX | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001130 | |||||||
WBGene00305252 | |||||||||
Transcript | C02C6.1b.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | C02C6.1b.1:c.208C>T | ||||||||
HGVSp | CE07832:p.Pro70Ser | ||||||||
cDNA_position | 208 | ||||||||
CDS_position | 208 | ||||||||
Protein_position | 70 | ||||||||
Exon_number | 2/8 | ||||||||
Codon_change | Cca/Tca | ||||||||
Amino_acid_change | P/S | ||||||||
C02C6.1a.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | C02C6.1a.1:c.208C>T | ||||||||
HGVSp | CE07833:p.Pro70Ser | ||||||||
cDNA_position | 208 | ||||||||
CDS_position | 208 | ||||||||
Protein_position | 70 | ||||||||
Exon_number | 2/10 | ||||||||
Codon_change | Cca/Tca | ||||||||
Amino_acid_change | P/S | ||||||||
C02C6.16 | |||||||||
Interactor (12) | |||||||||
Genetics | Interpolated_map_position | X | 22.8498 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00002892 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals retained their eggs at 25C. | Paper_evidence | WBPaper00002892 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002892 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002892 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000019 | Paper_evidence | WBPaper00002892 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited a reduced pharyngeal pumping rate (160 pumps per minute, n = 20, SD = 52, compared with 259 for wild-type animals, n = 20, SD = 13). | Paper_evidence | WBPaper00002892 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002892 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002892 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000031 | Paper_evidence | WBPaper00002892 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 97% eggs laid at 15C and transferred to 25C took twice as long to reach adulthood compared to animals maintained at 15C. | Paper_evidence | WBPaper00002892 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002892 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002892 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000050 | Paper_evidence | WBPaper00003831 | |||||||
WBPaper00002892 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals produced a reduced number of embryos (average = 56; n=9) at 25C, 52% of which were inviable. | Paper_evidence | WBPaper00003831 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Eggs laid by hermaphrodites that were maintained at 25C did not recover when they were transferred to 15C. | Paper_evidence | WBPaper00002892 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002892 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00003831 | |||||
WBPaper00002892 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00002892 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited a greatly diminished brood size at 25C with an average of 25 progeny (n = 20, SD = 8), compared with 161 for wild-type animals (strain N2; n = 20, SD = 24). | Paper_evidence | WBPaper00002892 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002892 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002892 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000208 | Paper_evidence | WBPaper00002892 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited a prolonged defecation cycle (62 s per cycle, n=10, SD=14, compared with 44 for wild-type animals, n=10, SD=4). | Paper_evidence | WBPaper00002892 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002892 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002892 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000241 | Paper_evidence | WBPaper00031805 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | A thermosensitive mutation, dyn-1(ky51), caused accumulation of refractile corpses that were negative for acridine orange in the adult hermaphrodite gonad | Paper_evidence | WBPaper00031805 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031805 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00031805 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000565 | Paper_evidence | WBPaper00044758 | |||||||
Curator_confirmed | WBPerson5063 | ||||||||
Remark | temperature sensitive phenotype rescued by FUdR | Paper_evidence | WBPaper00044758 | ||||||
Curator_confirmed | WBPerson5063 | ||||||||
Temperature_sensitive | Heat_sensitive | 28 | Paper_evidence | WBPaper00044758 | |||||
Curator_confirmed | WBPerson5063 | ||||||||
WBPhenotype:0000641 | Paper_evidence | WBPaper00030848 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals disperse less than WT. | Paper_evidence | WBPaper00030848 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were scored for distance traveled (mm) in 3 min. | Paper_evidence | WBPaper00030848 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20C | Paper_evidence | WBPaper00030848 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00030848 | |||||||
WBPaper00002892 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Reversible Unc. | Paper_evidence | WBPaper00030848 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals were wild-type or nearly wild-type when maintained at 15C, but became 100% uncoordinated (becoming sluggish and assuming a kinked posture) when shifted to 25C, within a minute. When shifted back to 15C, animals recover normal locomotion within minutes. Larvae were more rapidly and severely affected by the shift in temperature. Further decreases in the rate of movement were noted at 30C. | Paper_evidence | WBPaper00002892 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00002892 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002892 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00030848 | |||||
WBPaper00002892 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00030848 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001384 | Paper_evidence | WBPaper00002892 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited low fertility at 25C. | Paper_evidence | WBPaper00002892 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002892 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002892 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals had increased GFP in the pseudocoelom and greatly reduced uptake of GFP by coelomocytes. | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20, 25 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | dpy-20(e1282); arIs37[pmyo-3::ssGFP] | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001588 | Paper_evidence | WBPaper00062703 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | "Additionally, post-axotomy analyses revealed a greater proportion of microtubule growth in the retrograde direction in dyn-1 mutant animals compared to the wild-type (Figure 1 F)," <as viewed by pattern of EBP-2::GFP expression> | Paper_evidence | WBPaper00062703 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00062703 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were incubated for at least 2 hours at 25C before confocal imaging (top panels). | Paper_evidence | WBPaper00062703 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00062703 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001762 | Paper_evidence | WBPaper00003831 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | YP170::GFP protein, a full length yolk protein fusion, was only weakly accumulated in full-grown oocytes and embryos, instead it accumulated to a high level in the pseodocoelom. | Paper_evidence | WBPaper00003831 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00003831 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | YP170::GFP | Paper_evidence | WBPaper00003831 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001808 | Paper_evidence | WBPaper00031805 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Corpses in dyn-1(ky51) mutant worms were arrested in abnormally large phagosomes. No defects in the recognition of corpses, formation of phagocytic cups or actin halos around corpses or in corpse internalization | Paper_evidence | WBPaper00031805 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031805 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00031805 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001846 | Paper_evidence | WBPaper00031805 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In dyn-1(ky51) worms at the non-permissive temperature, phagosomal RAB-5 and RAB-7 staining was decreased, suggesting arrest at a stage before RAB-5 recruitment. Phagosomal recruitment of YFP::2FYVE was reduced in ky51 mutant worms, confirming that VPS-34 functions downstream of DYN-1 | Paper_evidence | WBPaper00031805 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031805 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00031805 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001989 | Paper_evidence | WBPaper00046162 | |||||||
Curator_confirmed | WBPerson2857 | ||||||||
Remark | Animals become paralyzed at the permissive temperature when exposed to atmospheres containing only 1000 ppm oxygen. | Paper_evidence | WBPaper00046162 | ||||||
Curator_confirmed | WBPerson2857 | ||||||||
WBPhenotype:0002394 | Paper_evidence | WBPaper00048406 | |||||||
Curator_confirmed | WBPerson17560 | ||||||||
Remark | Figure 3, unsealed phagosomes can be labeled by PLCδ1-PH and the membrane impermeable dye FM4-64. Loss of mtm-1, piki-1, lst-4, dyn-1 or ocrl-1 shows phagosome sealing defective; "The germ cell corpses in lst-4(lf) and dyn-1(lf) mutants were all labeled by FM4-64 and PLCδ1-PH, suggesting that phagosomal sealing is defective (Fig 3, J-M; and Fig S3, G-G''', H, and I)." | Paper_evidence | WBPaper00048406 | ||||||
Curator_confirmed | WBPerson17560 | ||||||||
WBPhenotype:0002478 | Paper_evidence | WBPaper00062703 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | "...one hour after axotomy, microtubule dynamics were significantly increased in dyn-1 mutants compared to wild-type animals (Figure 1 D-E)." <as viewed by pattern of EBP-2::GFP expression> | Paper_evidence | WBPaper00062703 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00062703 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were incubated for at least 2 hours at 25C before confocal imaging (top panels). | Paper_evidence | WBPaper00062703 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00062703 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000679 | Paper_evidence | WBPaper00028448 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | PKD-2::GFP dendritic and ciliary localization was not obviously altered in dyn-1(ky51) mutants. | Paper_evidence | WBPaper00028448 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00062703 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Pre-axotomy imaging and analysis showed no visible difference <in EBP-2::GFP pattern> between wild-type and dyn-1(ky51) mutant animals before axotomy (Figure 1 A-C). | Paper_evidence | WBPaper00062703 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00062703 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were incubated for at least 2 hours at 25C before confocal imaging (top panels). | Paper_evidence | WBPaper00062703 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00062703 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001260 | Paper_evidence | WBPaper00003831 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Oocytes were morphologically wild-type. | Paper_evidence | WBPaper00003831 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006797 | PATO:0000460 | Paper_evidence | WBPaper00003831 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00003831 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | YP170::GFP | Paper_evidence | WBPaper00003831 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info | Models_disease | DOID:0050709 | |||||||
Models_disease_in_annotation | WBDOannot00000798 | ||||||||
Reference (12) | |||||||||
Remark | missense, pro70 to ser within GTPase domain. email11 from wen chen | ||||||||
Method | Substitution_allele |