WormBase Tree Display for Variation: WBVar00088574
expand all nodes | collapse all nodes | view schema
| WBVar00088574 | Evidence | Paper_evidence | WBPaper00003977 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | m86 | |||||||
| Other_name | CE02205:p.Arg88Ter | ||||||||
| F33H1.1e.1:c.262C>T | |||||||||
| CE43609:p.Arg111Ter | |||||||||
| F33H1.1c.1:c.214C>T | |||||||||
| F33H1.1a.1:c.688C>T | |||||||||
| F33H1.1b.1:c.763C>T | |||||||||
| CE17763:p.Arg230Ter | |||||||||
| CE01567:p.Arg72Ter | |||||||||
| F33H1.1d.1:c.331C>T | |||||||||
| CE28019:p.Arg255Ter | |||||||||
| HGVSg | CHROMOSOME_II:g.10160814G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F33H1 | |||||
| Flanking_sequences | gcagactcgatcaacttgccgaacaatcaa | gagcttcccccgcaacggtatgaataaaac | |||||||
| Mapping_target | F33H1 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003977 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00006178 | ||||||||
| WBStrain00006236 | |||||||||
| WBStrain00006259 | |||||||||
| WBStrain00006383 | |||||||||
| WBStrain00022829 | |||||||||
| WBStrain00029254 | |||||||||
| WBStrain00052538 | |||||||||
| WBStrain00055951 | |||||||||
| WBStrain00055963 | |||||||||
| WBStrain00055964 | |||||||||
| WBStrain00055965 | |||||||||
| WBStrain00055966 | |||||||||
| WBStrain00055967 | |||||||||
| WBStrain00055968 | |||||||||
| WBStrain00055969 | |||||||||
| WBStrain00055970 | |||||||||
| WBStrain00055971 | |||||||||
| WBStrain00055972 | |||||||||
| WBStrain00055973 | |||||||||
| WBStrain00056000 | |||||||||
| WBStrain00056001 | |||||||||
| WBStrain00056002 | |||||||||
| WBStrain00056004 | |||||||||
| WBStrain00056005 | |||||||||
| WBStrain00056009 | |||||||||
| WBStrain00056013 | |||||||||
| WBStrain00056014 | |||||||||
| WBStrain00056027 | |||||||||
| WBStrain00056043 | |||||||||
| WBStrain00056055 | |||||||||
| WBStrain00056056 | |||||||||
| WBStrain00056059 | |||||||||
| WBStrain00056060 | |||||||||
| WBStrain00056062 | |||||||||
| Laboratory | DR | ||||||||
| JT | |||||||||
| NFB | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000914 | |||||||
| Transcript | F33H1.1c.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F33H1.1c.1:c.214C>T | ||||||||
| HGVSp | CE01567:p.Arg72Ter | ||||||||
| cDNA_position | 380 | ||||||||
| CDS_position | 214 | ||||||||
| Protein_position | 72 | ||||||||
| Exon_number | 4/9 | ||||||||
| Codon_change | Cga/Tga | ||||||||
| Amino_acid_change | R/* | ||||||||
| F33H1.1a.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F33H1.1a.1:c.688C>T | ||||||||
| HGVSp | CE17763:p.Arg230Ter | ||||||||
| cDNA_position | 713 | ||||||||
| CDS_position | 688 | ||||||||
| Protein_position | 230 | ||||||||
| Exon_number | 7/13 | ||||||||
| Codon_change | Cga/Tga | ||||||||
| Amino_acid_change | R/* | ||||||||
| F33H1.1b.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F33H1.1b.1:c.763C>T | ||||||||
| HGVSp | CE28019:p.Arg255Ter | ||||||||
| cDNA_position | 787 | ||||||||
| CDS_position | 763 | ||||||||
| Protein_position | 255 | ||||||||
| Exon_number | 8/14 | ||||||||
| Codon_change | Cga/Tga | ||||||||
| Amino_acid_change | R/* | ||||||||
| F33H1.1e.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F33H1.1e.1:c.262C>T | ||||||||
| HGVSp | CE02205:p.Arg88Ter | ||||||||
| cDNA_position | 262 | ||||||||
| CDS_position | 262 | ||||||||
| Protein_position | 88 | ||||||||
| Exon_number | 3/8 | ||||||||
| Codon_change | Cga/Tga | ||||||||
| Amino_acid_change | R/* | ||||||||
| F33H1.1d.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F33H1.1d.1:c.331C>T | ||||||||
| HGVSp | CE43609:p.Arg111Ter | ||||||||
| cDNA_position | 405 | ||||||||
| CDS_position | 331 | ||||||||
| Protein_position | 111 | ||||||||
| Exon_number | 5/11 | ||||||||
| Codon_change | Cga/Tga | ||||||||
| Amino_acid_change | R/* | ||||||||
| Interactor (54) | |||||||||
| Genetics | Interpolated_map_position | II | 2.13278 | ||||||
| Mapping_data | In_2_point | 444 | |||||||
| 769 | |||||||||
| 3381 | |||||||||
| In_multi_point | 338 | ||||||||
| 961 | |||||||||
| 1558 | |||||||||
| In_pos_neg_data | 4206 | ||||||||
| 4207 | |||||||||
| 4208 | |||||||||
| 4209 | |||||||||
| 4210 | |||||||||
| 4211 | |||||||||
| 4537 | |||||||||
| Description | Phenotype (19) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00002149 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Adult lifespan was not increased. Animals were allowed to progress through development at 15 degrees C. then shifted to 25.5 degrees C. to determine lifespan. | Paper_evidence | WBPaper00002149 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Animals were raised at 15C and placed at 25.5C as L4 larvae or young adults for the life span assay. | Paper_evidence | WBPaper00002149 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature | 25.5C | Paper_evidence | WBPaper00002149 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000315 | Paper_evidence | WBPaper00002149 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000436 | Paper_evidence | WBPaper00035062 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | In daf-19(m86) mutants, HYLS-1 localization was unaffected | Paper_evidence | WBPaper00035062 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000478 | Paper_evidence | WBPaper00002149 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000882 | Paper_evidence | WBPaper00003977 | |||||||
| Curator_confirmed | WBPerson641 | ||||||||
| Remark | Table 2, Figure1; concerns the microvilli at the dendritic tips of the thermosensory AFD neurons | Paper_evidence | WBPaper00003977 | ||||||
| Curator_confirmed | WBPerson641 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005662 | PATO:0000460 | Paper_evidence | WBPaper00003977 | ||||
| Curator_confirmed | WBPerson641 | ||||||||
| GO_term | GO:0005902 | PATO:0000460 | Paper_evidence | WBPaper00003977 | |||||
| Curator_confirmed | WBPerson641 | ||||||||
| GO:0030425 | PATO:0000460 | Paper_evidence | WBPaper00003977 | ||||||
| Curator_confirmed | WBPerson641 | ||||||||
| WBPhenotype:0001530 | Paper_evidence | WBPaper00000932 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | CEP does not stain with FITC at permissive or non-permissive temperatures. | Paper_evidence | WBPaper00000932 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005107 | PATO:0000460 | Paper_evidence | WBPaper00000932 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 15C, 25C | Paper_evidence | WBPaper00000932 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001535 | Paper_evidence | WBPaper00002149 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | No FITC staining of ADE or PDE. | Paper_evidence | WBPaper00002149 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference (24) | |||||||||
| Remark | |||||||||
| Method | Substitution_allele |
