WormBase Tree Display for Variation: WBVar00088762
expand all nodes | collapse all nodes | view schema
WBVar00088762 | Evidence | Paper_evidence | WBPaper00004111 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ma104 | ||||||
Sequence_details | SMap | S_parent | Sequence | C12C8 | ||||
Flanking_sequences | aaaaaaaatttcagagcgattcgtgagcgtc | aaacagtgatctatgtgcaactccgcgatg | ||||||
Mapping_target | C12C8 | |||||||
Type_of_mutation | Insertion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Transposon_insertion | Tc1 | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00005178 | |||||||
WBStrain00029079 | ||||||||
WBStrain00040229 | ||||||||
Laboratory | VT | |||||||
Status | Live | |||||||
Affects (3) | ||||||||
Genetics | Interpolated_map_position | I | 3.75179 | |||||
Mapping_data | In_2_point | 3934 | ||||||
In_multi_point | 1445 | |||||||
In_pos_neg_data | 3935 | |||||||
Description | Phenotype (16) | |||||||
Phenotype_not_observed | WBPhenotype:0000145 | Paper_evidence | WBPaper00031590 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 100% animals (n>100) produced fertilized eggs. | Paper_evidence | WBPaper00031590 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031590 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00031590 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000743 | Paper_evidence | WBPaper00027057 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | lin-41(ma104) homozygotes are sensitive to RNAi and do not exhibit defects in miRNA processing (data not shown). | Paper_evidence | WBPaper00027057 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00040868 | |||||||
WBPaper00003929 | ||||||||
WBPaper00036739 | ||||||||
WBPaper00027057 | ||||||||
WBPaper00031590 | ||||||||
WBPaper00027716 | ||||||||
WBPaper00031953 | ||||||||
WBPaper00011140 | ||||||||
WBPaper00032117 | ||||||||
WBPaper00042320 | ||||||||
Method | Transposon_insertion |