WormBase Tree Display for Variation: WBVar00088765
expand all nodes | collapse all nodes | view schema
WBVar00088765 | Evidence | Paper_evidence | WBPaper00004705 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ma116 | |||||||
Other_name | F46B6.3b.1:c.141-1G>A | ||||||||
F46B6.3a.1:c.141-1G>A | |||||||||
HGVSg | CHROMOSOME_V:g.9777550C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F46B6 | |||||
Flanking_sequences | tttgcttctaaagtcataaacattttttca | gttcgaccgatgtgcttatgcaacgcttac | |||||||
Mapping_target | F46B6 | ||||||||
Type_of_mutation | Substitution | G | A | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004551 | ||||||||
WBStrain00004567 | |||||||||
Laboratory | VT | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Genetics | Interpolated_map_position | V | 2.19428 | ||||||
Mapping_data (3) | |||||||||
Description | Phenotype | WBPhenotype:0000506 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | adult male has swollen bursa | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000697 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | adult hermaphrodite has protruding vulva | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001538 | Paper_evidence | WBPaper00001192 | |||||||
WBPaper00001813 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Isolated as a suppressor of lin-29(n546). Suppresses paralysis in unc-54(r293), sterility in tra-2(e1209), Egl and alae defects in lin-29(n546) and Dpy phenotype in dpy-5(e61). The unc-54 phenotype was suppressed with maternal effect. | Paper_evidence | WBPaper00001192 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Increases the steady state level of unc-54 mutant mRNAs (altered 3' UTR and nonsense mutations). | Paper_evidence | WBPaper00001813 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001192 | |||||||
WBPaper00001813 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00001192 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0001828 | Paper_evidence | WBPaper00004325 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutant smg-3 and smg-4 animals gave a weak, variable response, suggesting that smg-3 or smg-4 may not be required for persistence of RNAi | Paper_evidence | WBPaper00004325 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | RNAi injection | Paper_evidence | WBPaper00004325 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00013705 | ||||||||
WBPaper00004325 | |||||||||
WBPaper00001192 | |||||||||
WBPaper00021643 | |||||||||
WBPaper00001813 | |||||||||
WBPaper00022962 | |||||||||
WBPaper00017298 | |||||||||
Remark | Substitution is at the end of the first intron [030411 ck1] | ||||||||
Method | Substitution_allele |