WormBase Tree Display for Variation: WBVar00088765
expand all nodes | collapse all nodes | view schema
WBVar00088765 | Evidence | Paper_evidence | WBPaper00004705 | ||
---|---|---|---|---|---|
Name | Public_name | ma116 | |||
Other_name | F46B6.3b.1:c.141-1G>A | ||||
F46B6.3a.1:c.141-1G>A | |||||
HGVSg | CHROMOSOME_V:g.9777550C>T | ||||
Sequence_details | SMap | S_parent | Sequence | F46B6 | |
Flanking_sequences | tttgcttctaaagtcataaacattttttca | gttcgaccgatgtgcttatgcaacgcttac | |||
Mapping_target | F46B6 | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00004551 | ||||
WBStrain00004567 | |||||
Laboratory | VT | ||||
Status | Live | ||||
Affects | Gene | WBGene00004882 | |||
Transcript (2) | |||||
Interactor | WBInteraction000517351 | ||||
WBInteraction000517352 | |||||
WBInteraction000517353 | |||||
WBInteraction000517354 | |||||
WBInteraction000518885 | |||||
WBInteraction000518890 | |||||
Genetics | Interpolated_map_position | V | 2.19428 | ||
Mapping_data | In_2_point | 3387 | |||
In_multi_point | 1192 | ||||
3101 | |||||
3102 | |||||
In_pos_neg_data | 4574 | ||||
4575 | |||||
Description (2) | |||||
Reference | WBPaper00013705 | ||||
WBPaper00004325 | |||||
WBPaper00001192 | |||||
WBPaper00021643 | |||||
WBPaper00001813 | |||||
WBPaper00022962 | |||||
WBPaper00017298 | |||||
Remark | Substitution is at the end of the first intron [030411 ck1] | ||||
Method | Substitution_allele |