WormBase Tree Display for Variation: WBVar00088799

WBVar00088799 Evidence: Paper_evidence: WBPaper00004985
  Name: Public_name: md69
    Other_name: ZC416.8a.1:c.308G>A
      CE17307:p.Gly103Glu
      ZC416.8b.1:c.-1+1468G>A
    HGVSg: CHROMOSOME_IV:g.3623164C>T
  Sequence_details: SMap: S_parent: Sequence: ZC416
    Flanking_sequences: ttaactttttggatgaggagctggaattgg atggctcttcgcttcaaaagctttgctgca
    Mapping_target: ZC416
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00004985
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: RM
    Status: Live
  Affects: Gene: WBGene00006756
      WBGene00000481
    Transcript: ZC416.8a.1 (12)
      ZC416.8b.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: ZC416.8b.1:c.-1+1468G>A
        Intron_number: 1/11
  Genetics: Interpolated_map_position: IV -3.08613
  Reference: WBPaper00004985
  Remark: Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006756 Missense 342 G to E Paper_evidence: WBPaper00004985
  Method: Substitution_allele