WormBase Tree Display for Variation: WBVar00088823

WBVar00088823 Evidence: Paper_evidence: WBPaper00004985
  Name: Public_name: md334
    Other_name: ZC416.8a.1:c.1039G>C
      ZC416.8b.1:c.1-1285G>C
      CE17307:p.Gly347Arg
    HGVSg: CHROMOSOME_IV:g.3619060C>G
  Sequence_details: SMap: S_parent: Sequence: ZC416
    Flanking_sequences: tggtataggggattgcaaaacacgcgattc ctccatagccaacccaaccatagcaatcgc
    Mapping_target: ZC416
    Type_of_mutation: Substitution: c g Curator_confirmed: WBPerson4055
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: RM
    Status: Live
  Affects: Gene: WBGene00006756
      WBGene00000481
    Transcript: ZC416.8a.1 (12)
      ZC416.8b.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: ZC416.8b.1:c.1-1285G>C
        Intron_number: 1/11
  Genetics: Interpolated_map_position: IV -3.11559
  Reference: WBPaper00004985
  Remark: Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues.
    [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand Curator_confirmed: WBPerson4055
    Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006756 Missense 347 G to R Paper_evidence: WBPaper00004985
  Method: Substitution_allele