WormBase Tree Display for Variation: WBVar00088824

WBVar00088824 Evidence: Paper_evidence: WBPaper00004985
  Name: Public_name: md414
    Other_name: ZC416.8a.1:c.1109G>A
      CE17307:p.Cys370Tyr
      ZC416.8b.1:c.1-1215G>A
    HGVSg: CHROMOSOME_IV:g.3618990C>T
  Sequence_details: SMap: S_parent: Sequence: ZC416
    Flanking_sequences: tgcaacttgtcatcccgctctcttttgtat cttcggaatcgccttgatcgacacctcgct
    Mapping_target: ZC416
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00004985
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: RM
    Status: Live
  Affects: Gene: WBGene00006756
      WBGene00000481
    Transcript: ZC416.8a.1 (12)
      ZC416.8b.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: ZC416.8b.1:c.1-1215G>A
        Intron_number: 1/11
  Genetics: Interpolated_map_position: IV -3.11564
  Reference: WBPaper00004985
  Remark: Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006756 Missense 370 C to Y Paper_evidence: WBPaper00004985
  Method: Substitution_allele