WormBase Tree Display for Variation: WBVar00088915
expand all nodes | collapse all nodes | view schema
WBVar00088915 | Evidence | Paper_evidence | WBPaper00004727 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | mg158 | |||||
Other_name | C40H5.5a.1:c.1018T>A | ||||||
CE43132:p.Phe312Ile | |||||||
CE27107:p.Phe340Ile | |||||||
C40H5.5b.1:c.934T>A | |||||||
HGVSg | CHROMOSOME_X:g.11764947A>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C40H5 | |||
Flanking_sequences | ctcgacggtattttgcacgagcattttgaa | ccaaacctggaaacaaaagtagttctggat | |||||
Mapping_target | C40H5 | ||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00029272 | ||||||
WBStrain00029472 | |||||||
WBStrain00029473 | |||||||
WBStrain00029474 | |||||||
Laboratory | GR | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006654 | |||||
Transcript | C40H5.5b.1 (12) | ||||||
C40H5.5a.1 (12) | |||||||
Interactor | WBInteraction000003412 | ||||||
WBInteraction000003413 | |||||||
WBInteraction000003414 | |||||||
WBInteraction000003415 | |||||||
WBInteraction000003416 | |||||||
WBInteraction000521604 | |||||||
WBInteraction000569171 | |||||||
Genetics | Interpolated_map_position | X | 6.70739 | ||||
Description (2) | |||||||
Reference | WBPaper00029060 | ||||||
WBPaper00004906 | |||||||
WBPaper00004727 | |||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Method | Substitution_allele |