WormBase Tree Display for Variation: WBVar00088915
expand all nodes | collapse all nodes | view schema
WBVar00088915 | Evidence | Paper_evidence | WBPaper00004727 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | mg158 | ||||||
Other_name | C40H5.5a.1:c.1018T>A | |||||||
CE43132:p.Phe312Ile | ||||||||
CE27107:p.Phe340Ile | ||||||||
C40H5.5b.1:c.934T>A | ||||||||
HGVSg | CHROMOSOME_X:g.11764947A>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C40H5 | ||||
Flanking_sequences | ctcgacggtattttgcacgagcattttgaa | ccaaacctggaaacaaaagtagttctggat | ||||||
Mapping_target | C40H5 | |||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00029272 | |||||||
WBStrain00029472 | ||||||||
WBStrain00029473 | ||||||||
WBStrain00029474 | ||||||||
Laboratory | GR | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006654 | ||||||
Transcript | C40H5.5b.1 (12) | |||||||
C40H5.5a.1 (12) | ||||||||
Interactor | WBInteraction000003412 | |||||||
WBInteraction000003413 | ||||||||
WBInteraction000003414 | ||||||||
WBInteraction000003415 | ||||||||
WBInteraction000003416 | ||||||||
WBInteraction000521604 | ||||||||
WBInteraction000569171 | ||||||||
Genetics | Interpolated_map_position | X | 6.70739 | |||||
Description | Phenotype | WBPhenotype:0001278 | Paper_evidence | WBPaper00004727 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Animals were defective in autoregulation of a ttx-3prom::gfp reporter gene in the AIY interneuron. In Wildtype the expression is strong, in contrast, expression is mostly undetectable in these mutants. | Paper_evidence | WBPaper00004727 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Genotype | ttx-3prom::gfp (mgIs18) | Paper_evidence | WBPaper00004727 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0002513 | Paper_evidence | WBPaper00004727 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Thermotaxis defects mimic those seen upon laser ablation of the AIY interneurons. | Paper_evidence | WBPaper00004727 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_not_observed (2) | ||||||||
Reference | WBPaper00029060 | |||||||
WBPaper00004906 | ||||||||
WBPaper00004727 | ||||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | |||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | ||||||
Method | Substitution_allele |