WormBase Tree Display for Variation: WBVar00088922
expand all nodes | collapse all nodes | view schema
WBVar00088922 | Evidence | Paper_evidence | WBPaper00003929 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | mg279 | ||||||
Sequence_details | SMap | S_parent | Sequence | C05G5 | ||||
Flanking_sequences | taacaacaagtactaatccatttttcaggc | ctgtggatccggtgaggtagtaggttgtat | ||||||
Mapping_target | C05G5 | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00007921 | |||||||
WBStrain00007922 | ||||||||
Laboratory | GR | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00002285 | ||||||
Transcript | C05G5.6 | |||||||
Interactor (146) | ||||||||
Genetics | Interpolated_map_position | X | 21.2133 | |||||
Description | Phenotype | WBPhenotype:0000280 | Paper_evidence | WBPaper00003929 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Some animals had patches of alae rather than continuous alae, indicating a mix of larval fates for some V cells and adult fates for others. | Paper_evidence | WBPaper00003929 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000438 | Paper_evidence | WBPaper00003929 | ||||||
WBPaper00040868 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | mg279 failed to complement n2853 and caused a weak retarded phenotype. | Paper_evidence | WBPaper00003929 | |||||
Curator_confirmed | WBPerson712 | |||||||
weak allele. weakly fails (2% of the time) to express a reporter gene for an adult-specific collagen, col-19::gfp; fails to produce alae, an adult-specific cuticle structure, at the nominal adult stage | Paper_evidence | WBPaper00040868 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003950 | Paper_evidence | WBPaper00040868 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001014 | Paper_evidence | WBPaper00046672 | ||||||
Curator_confirmed | WBPerson13173 | |||||||
Remark | let-7(mg279) mutants exhibits enhanced pathogen resistance against Pseudomonas aeruginosa infection. | Paper_evidence | WBPaper00046672 | |||||
Curator_confirmed | WBPerson13173 | |||||||
Reference | WBPaper00040868 | |||||||
WBPaper00003929 | ||||||||
WBPaper00026508 | ||||||||
WBPaper00026396 | ||||||||
WBPaper00046672 | ||||||||
Method | Deletion_allele |