WormBase Tree Display for Variation: WBVar00089072
expand all nodes | collapse all nodes | view schema
WBVar00089072 | Evidence | Paper_evidence | WBPaper00031061 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | mn156 | |||||||
Other_name | CE41239:p.Glu497Gly | ||||||||
F41E6.4a.1:c.1490A>G | |||||||||
F41E6.4b.1:c.782A>G | |||||||||
F41E6.4b.2:c.782A>G | |||||||||
CE41240:p.Glu261Gly | |||||||||
HGVSg | CHROMOSOME_V:g.8612640A>G | ||||||||
Sequence_details | SMap | S_parent | Sequence | F41E6 | |||||
Flanking_sequences | ctgagctttttgggcaactgatcagtgaag | aacagatgttattcgtcggcgagatctggc | |||||||
Mapping_target | F41E6 | ||||||||
Type_of_mutation | Substitution | a | g | Paper_evidence | WBPaper00031061 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00034248 | ||||||||
Laboratory | SP | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00018285 | |||||||
Transcript | F41E6.4b.2 (12) | ||||||||
F41E6.4b.1 (12) | |||||||||
F41E6.4a.1 (12) | |||||||||
Interactor | WBInteraction000519226 | ||||||||
Genetics | Interpolated_map_position | V | 1.48583 | ||||||
Mapping_data | In_multi_point | 362 | |||||||
363 | |||||||||
366 | |||||||||
Description | Phenotype | WBPhenotype:0000228 | Paper_evidence | WBPaper00000565 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Non-Unc revertants of unc-58 were observed on 5/18 plates. | Paper_evidence | WBPaper00000565 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | unc-58(e665) | Paper_evidence | WBPaper00000565 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000275 | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals have extreme sensitivity to UV radiation. | Paper_evidence | WBPaper00000565 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | UV sensitivities were measured as % survival based on radiation dose. Alkaline bleach isolated eggs ranging in age from 30-180 minutes were aliquoted to plates to give between 25-300 survivors/plate. The plated eggs were irradiated at different doses at a rate of 1Jm 10X-2/sec. Irradiated animals were protected from light. Survival was scored as the % animals reaching adulthood 4-6 days after irradiation relative to un-irradiated controls. | Paper_evidence | WBPaper00000565 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00048917 | |||||||
Curator_confirmed | WBPerson721 | ||||||||
Remark | HIM was significant in one experiment but not the other | Paper_evidence | WBPaper00048917 | ||||||
Curator_confirmed | WBPerson721 | ||||||||
WBPhenotype:0001666 | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals have extreme sensitivity to X-ray radiation. | Paper_evidence | WBPaper00000565 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | X-ray sensitivities were measured as % survival based on radiation dose. Alkaline bleach isolated eggs ranging in age from 30-180 minutes were aliquoted to plates to give between 25-300 survivors/plate. The plated eggs were irradiated at different doses at a rate of 470 r/min. Survival was scored as the % animals reaching adulthood 4-6 days after irradiation relative to un-irradiated controls. | Paper_evidence | WBPaper00000565 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001667 | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are hypersensitive to MMS in a chronic exposure assay where the progeny of L4 larvae exposed to MMS for 24 hours were tested for developmental arrest. Animals are not hypersensitive to MMS exposure in the other chronic sensitivity assay. | Paper_evidence | WBPaper00000565 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were tested in two chronic and 1 acute drug exposure assays: 1. gravid adults were placed on plates containing various concentrations of MMS and allowed to develop; 2. L4 larvae were incubated on plates containing various concentrations of MMS for 24 hours, their progeny were scored for predominant stage of developmental arrest after further incubation; 3. acute exposure was assayed by incubating eggs in 50mM MMS for various times before plating and ounting egg hatch and survival to adulthood. | Paper_evidence | WBPaper00000565 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000050 | Paper_evidence | WBPaper00000565 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000392 | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were indistinguishable in appearance from wild type. | Paper_evidence | WBPaper00000565 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000673 | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Brood sizes were similar to that of wild type. | Paper_evidence | WBPaper00000565 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00000565 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000742 | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Recombination frequencies were measured using unlinked intervals, dpy-10 unc-4 or dpy-7 unc-3. | Paper_evidence | WBPaper00000565 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000784 | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Male fertility was 87% that of wild type. | Paper_evidence | WBPaper00000565 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001631 | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males produced equal numbers of X-bearing and nullo-X-bearing sperm. | Paper_evidence | WBPaper00000565 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000565 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00000565 | ||||||||
WBPaper00015284 | |||||||||
WBPaper00048917 | |||||||||
Remark | In addition to the lesion described the mn156 allele also has D581G and D704G mutations | Paper_evidence | WBPaper00031061 | ||||||
Method | Substitution_allele |