WormBase Tree Display for Variation: WBVar00089399
expand all nodes | collapse all nodes | view schema
WBVar00089399 | Evidence | Paper_evidence | WBPaper00003566 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n299 | |||||||
Other_name | C09H6.2b.1:c.532+3_1689del | ||||||||
C09H6.2a.1:c.532+3_1773del | |||||||||
C09H6.2c.1:c.379+3_1620del | |||||||||
HGVSg | CHROMOSOME_I:g.8113723_8117327del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C09H6 | |||||
Flanking_sequences | acggaaacaagcggcgttgttcaaaataatggt | gaaagtaagttgtgaacttttttaaaacttg | |||||||
Mapping_target | C09H6 | ||||||||
Type_of_mutation | Insertion | ||||||||
Deletion | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002999 | |||||||
Transcript | C09H6.2c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C09H6.2c.1:c.379+3_1620del | ||||||||
cDNA_position | ?-1620 | ||||||||
CDS_position | ?-1620 | ||||||||
Protein_position | ?-540 | ||||||||
Intron_number | 3-8/14 | ||||||||
Exon_number | 4-9/15 | ||||||||
C09H6.2b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C09H6.2b.1:c.532+3_1689del | ||||||||
cDNA_position | ?-1692 | ||||||||
CDS_position | ?-1689 | ||||||||
Protein_position | ?-563 | ||||||||
Intron_number | 5-9/16 | ||||||||
Exon_number | 6-10/17 | ||||||||
C09H6.2a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C09H6.2a.1:c.532+3_1773del | ||||||||
cDNA_position | ?-1774 | ||||||||
CDS_position | ?-1773 | ||||||||
Protein_position | ?-591 | ||||||||
Intron_number | 5-10/17 | ||||||||
Exon_number | 6-11/18 | ||||||||
Genetics | Interpolated_map_position | I | 2.55902 | ||||||
Description | Phenotype | WBPhenotype:0000698 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | 16 percent of Vul hermaphrodites have 1 or more ventral protrusions. | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 97 | 97 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001410 | Paper_evidence | WBPaper00003566 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Both 140- and 70-kDa bands are absent in protein extracts from lin-10(n299) and lin-10(sy217) mutants. | Paper_evidence | WBPaper00003566 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Western blotting experiments using anti-LIN-10 antibodies | Paper_evidence | WBPaper00003566 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00013806 | ||||||||
WBPaper00000762 | |||||||||
WBPaper00003566 | |||||||||
Remark | exons 4-9 (4.7 kb of C09H6.2) are deleted and there is an insertion of ~300 kb of DNA (spanning cosmids ZK858-DY3) in an inverted orientation. | Paper_evidence | WBPaper00003566 | ||||||
300 kb of DNA (spanning cosmids ZK858-DY3) in an inverted orientation | Paper_evidence | WBPaper00003566 | |||||||
Method | Deletion_and_insertion_allele |