WormBase Tree Display for Variation: WBVar00089424
expand all nodes | collapse all nodes | view schema
WBVar00089424 | Evidence | Paper_evidence | WBPaper00031068 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | n324 | |||||
Other_name | CE25115:p.Leu444Ter | ||||||
T19B4.7.1:c.1331T>A | |||||||
HGVSg | CHROMOSOME_I:g.5685157A>T | ||||||
Sequence_details | SMap | S_parent | Sequence | T19B4 | |||
Flanking_sequences | cgagaaccagaagacgtcgaacggaggcct | acggtgcagacgaagtcattggaactcctg | |||||
Mapping_target | T19B4 | ||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00024161 | ||||||
WBStrain00026722 | |||||||
Laboratory | MT | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006776 | |||||
Transcript | T19B4.7.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | T19B4.7.1:c.1331T>A | ||||||
HGVSp | CE25115:p.Leu444Ter | ||||||
cDNA_position | 1394 | ||||||
CDS_position | 1331 | ||||||
Protein_position | 444 | ||||||
Exon_number | 10/19 | ||||||
Codon_change | tTa/tAa | ||||||
Amino_acid_change | L/* | ||||||
Interactor | WBInteraction000500889 | ||||||
WBInteraction000518897 | |||||||
WBInteraction000518900 | |||||||
WBInteraction000536176 | |||||||
WBInteraction000536177 | |||||||
WBInteraction000536178 | |||||||
WBInteraction000536179 | |||||||
WBInteraction000536180 | |||||||
Genetics | Interpolated_map_position | I | 0.309528 | ||||
Description | Phenotype (26) | ||||||
Phenotype_not_observed (2) | |||||||
Reference | WBPaper00038152 | ||||||
WBPaper00040147 | |||||||
WBPaper00043908 | |||||||
WBPaper00035198 | |||||||
WBPaper00001105 | |||||||
WBPaper00032907 | |||||||
WBPaper00036485 | |||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Method | Substitution_allele |