WormBase Tree Display for Variation: WBVar00089466
expand all nodes | collapse all nodes | view schema
WBVar00089466 | Evidence | Paper_evidence | WBPaper00003778 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n378 | |||||||
Other_name (14) | |||||||||
HGVSg | CHROMOSOME_IV:g.11059404G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F36H1 | |||||
Flanking_sequences | ttttccattcaaatatcaataaaagtttca | aatcgtgtctcccttcgtggtttcgtcaag | |||||||
Mapping_target | F36H1 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003778 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026727 | ||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Linked_to | WBVar00089467 | ||||||||
Affects | Gene | WBGene00002992 | |||||||
Transcript (11) | |||||||||
Interactor (15) | |||||||||
Genetics | Interpolated_map_position | IV | 4.82045 | ||||||
Description | Phenotype | WBPhenotype:0000219 | Paper_evidence | WBPaper00031110 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Underinduced animals (worms with fewer than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00031110 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000640 | Paper_evidence | WBPaper00002811 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002811 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00000762 | |||||||
WBPaper00002375 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | 14 percent of Vul hermaphrodites have 1 or more ventral protrusions. The penetrance of the Vul phenotype in n378 hermaphrodites that pass through a dauer larval stage drops to 70 percent. Additionally, 42 percent of these post-dauer Vul hermaphrodites have 1 or more ventral protrusions. | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
On average less than one VPC adopts a vulval fate. | Paper_evidence | WBPaper00002375 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 97 | 97 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0001278 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | neurons did not show a loss in unc-25::GFP expression | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014913 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005027 | PATO:0000460 | Paper_evidence | WBPaper00057074 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005021 | PATO:0000460 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (17) | |||||||||
Method | Substitution_allele |