WormBase Tree Display for Variation: WBVar00089527
expand all nodes | collapse all nodes | view schema
WBVar00089527 | Evidence | Paper_evidence | WBPaper00002370 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n480 | |||||||
Other_name | CE45947:p.Gly59Glu | ||||||||
F28C1.2c.1:c.176G>A | |||||||||
F28C1.2b.1:c.176G>A | |||||||||
F28C1.2a.1:c.176G>A | |||||||||
CE46003:p.Gly59Glu | |||||||||
CE24928:p.Gly59Glu | |||||||||
HGVSg | CHROMOSOME_V:g.12460032C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F28C1 | |||||
Flanking_sequences | ttctgtcaaaagttccatctgtattcaccg | acaagatctgattggatggatcatgaaaaa | |||||||
Mapping_target | F28C1 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002370 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001179 | |||||||
Transcript | F28C1.2c.1 (12) | ||||||||
F28C1.2b.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious | |||||||
PolyPhen | 1 | probably_damaging | |||||||
HGVSc | F28C1.2b.1:c.176G>A | ||||||||
HGVSp | CE45947:p.Gly59Glu | ||||||||
cDNA_position | 176 | ||||||||
CDS_position | 176 | ||||||||
Protein_position | 59 | ||||||||
Exon_number | 2/10 | ||||||||
Codon_change | gGa/gAa | ||||||||
Amino_acid_change | G/E | ||||||||
F28C1.2a.1 (12) | |||||||||
Genetics | Interpolated_map_position | V | 4.2605 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000339 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slight bloating | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000545 | Paper_evidence | WBPaper00000635 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Both late-stage and eggs that are not late-stage are laid. | Paper_evidence | WBPaper00000635 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00000635 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_not_observed | WBPhenotype:0000641 | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Dispersal index in the absence of anesthetic ~0.80 is decreased compared to N2 ~0.90. | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Dispersal assay as reported in Crowder et al.1996; van Swinderen et al. 1997. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001068 | Paper_evidence | WBPaper00000635 | |||||||
WBPaper00001133 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson2021 | |||||||||
WBPerson712 | |||||||||
Remark | stimulated by serotonin and by imipramine | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001340 | Paper_evidence | WBPaper00000635 | |||||||
WBPaper00001133 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson2021 | |||||||||
WBPerson712 | |||||||||
Remark | stimulated by imipramine | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001618 | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit an EC50 for halothane statistically insignificant from that of N2 as determined by a concentration-response curve based on animal dispersal indexes. | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001705 | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001619 | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit an EC50 for isoflurane statistically insignificant from that of N2 as determined by a concentration-response curve based on animal dispersal indexes. | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004563 | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00000635 | ||||||||
WBPaper00001133 | |||||||||
WBPaper00004721 | |||||||||
WBPaper00011223 | |||||||||
Method | Substitution_allele |