WormBase Tree Display for Variation: WBVar00089530

WBVar00089530 Evidence: Paper_evidence: WBPaper00006298
  Name: Public_name: n483
    Other_name (17)
    HGVSg: CHROMOSOME_X:g.5673109C>T
  Sequence_details: SMap: S_parent: Sequence: W01C8
    Flanking_sequences: ggctgagcaaattgcacatggagcagcacc ggactatcggtacagaccacgtccgaagag
    Mapping_target: W01C8
    Type_of_mutation: Substitution: c t
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00026783
    Laboratory: MT
    Status: Live
  Affects: Gene: WBGene00001182
    Transcript (11)
  Genetics: Interpolated_map_position: X -4.40653
    Mapping_data: In_2_point: 723
      In_multi_point: 617
        732
  Description: Phenotype (25)
    Phenotype_not_observed: WBPhenotype:0001336 Paper_evidence: WBPaper00000635
        Curator_confirmed: WBPerson48
        Phenotype_assay: Treatment: As described in Hodgkin, Horvitz, and Brenner (1979), six L4 males and six L4 dpy-11 hermaphrodites incubated for 24 hours, males removed, and hermaphrodites transferred to fresh dishes each day. Cross-progeny are counted. Paper_evidence: WBPaper00000635
              Curator_confirmed: WBPerson48
  Reference: WBPaper00043908
    WBPaper00000635
    WBPaper00006298
    WBPaper00026078
  Method: Substitution_allele