WormBase Tree Display for Variation: WBVar00089648
expand all nodes | collapse all nodes | view schema
| WBVar00089648 | Evidence | Paper_evidence | WBPaper00006135 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | n659 | |||||
| Other_name | F34D6.3.1:c.111+1G>C | ||||||
| HGVSg | CHROMOSOME_II:g.2686866C>G | ||||||
| Sequence_details | SMap | S_parent | Sequence | F34D6 | |||
| Flanking_sequences | gatttttaacgggctcaccgagccctctta | ctgcagaatctcattctccgtctccagcgc | |||||
| Mapping_target | F34D6 | ||||||
| Type_of_mutation | Substitution | c | g | Curator_confirmed | WBPerson4055 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | MT | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006318 | |||||
| Transcript | F34D6.3.1 | VEP_consequence | splice_donor_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F34D6.3.1:c.111+1G>C | ||||||
| Intron_number | 2/9 | ||||||
| Isolation | Mutagen | EMS | Paper_evidence | WBPaper00006135 | |||
| Genetics | Interpolated_map_position | II | -12.1324 | ||||
| Reference | WBPaper00006135 | ||||||
| Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
| [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
| Method | Substitution_allele |
