WormBase Tree Display for Variation: WBVar00089688
expand all nodes | collapse all nodes | view schema
WBVar00089688 | Evidence | Paper_evidence | WBPaper00003698 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n703 | |||||||
Other_name | F43G9.14:n.56C>T | ||||||||
F43G9.19:n.50G>A | |||||||||
HGVSg | CHROMOSOME_I:g.8633348G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F43G9 | |||||
Flanking_sequences | tagaaaatagacagacggcgttgaaattag | tatgatgtaacaggtcatgaactgtgtcac | |||||||
Mapping_target | F43G9 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003698 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (14) | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Linked_to | WBVar00089689 | ||||||||
Affects (3) | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | I | 3.01058 | ||||||
Mapping_data | In_multi_point (12) | ||||||||
Description | Phenotype | WBPhenotype:0000184 | Paper_evidence | WBPaper00031670 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited 100, 99 and 94% NSM sister cell survival at 15, 20 and 25C, respectively. | Paper_evidence | WBPaper00031670 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00031670 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031670 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003666 | PATO:0000460 | Paper_evidence | WBPaper00031670 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15, 20, 25 | Paper_evidence | WBPaper00031670 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | bcIs25[Ptph-1::GFP] | Paper_evidence | WBPaper00031670 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000266 | Paper_evidence | WBPaper00031670 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Division of the NSM neuroblast sometimes occurred along the ventral/medial to dorsal/lateral axis, which is reverse from the wild type cleavage plane, along the ventral/lateral to dorsal/media axis. | Paper_evidence | WBPaper00031670 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00031670 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031670 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003666 | PATO:0000460 | Paper_evidence | WBPaper00031670 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | bcIs25; dtIs372 | Paper_evidence | WBPaper00031670 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001172 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | sisters of NSM, I2 fail to undergo programmed cell death (gf allele) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001585 | Paper_evidence | WBPaper00031670 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | On average in wild-type animals, NSM sister cell is 0.46 times the size of NSM, whereas it was 0.94 in n703 animals. | Paper_evidence | WBPaper00031670 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031670 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003666 | PATO:0000460 | Paper_evidence | WBPaper00031670 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | tIs38 (Ppie-1gfp::ph(PLC1d1)) | Paper_evidence | WBPaper00031670 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001681 | Paper_evidence | WBPaper00031670 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit altered placement of the mitotic spindle along the cell division axis in the NSM neuroblast. | Paper_evidence | WBPaper00031670 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00031670 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031670 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003666 | PATO:0000460 | Paper_evidence | WBPaper00031670 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | bcIs25; dtIs372 | Paper_evidence | WBPaper00031670 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001271 | Paper_evidence | WBPaper00004574 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | These mutants were not more susceptible than wild-type worms to Salmonella-mediated killing | Paper_evidence | WBPaper00004574 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00032446 | ||||||||
WBPaper00013699 | |||||||||
WBPaper00016476 | |||||||||
WBPaper00004574 | |||||||||
WBPaper00031670 | |||||||||
WBPaper00015203 | |||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000468 Genomic_neighbourhood | ||||||||
Method | Substitution_allele |