WormBase Tree Display for Variation: WBVar00089967
expand all nodes | collapse all nodes | view schema
WBVar00089967 | Evidence | Paper_evidence | WBPaper00002370 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n1125 | |||||||
Other_name | CE45947:p.Glu446Lys | ||||||||
CE46003:p.Glu446Lys | |||||||||
F28C1.2c.1:c.1336G>A | |||||||||
F28C1.2a.1:c.1336G>A | |||||||||
F28C1.2b.1:c.1336G>A | |||||||||
CE24928:p.Glu446Lys | |||||||||
HGVSg | CHROMOSOME_V:g.12457142C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F28C1 | |||||
Flanking_sequences | caaaaattccttgacaaagaatattctgga | aaaacttgcggttttggtgggaggtacaaa | |||||||
Mapping_target | F28C1 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002370 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001179 | |||||||
Transcript | F28C1.2c.1 (12) | ||||||||
F28C1.2b.1 (12) | |||||||||
F28C1.2a.1 (12) | |||||||||
Genetics | Interpolated_map_position | V | 4.2548 | ||||||
Mapping_data | In_multi_point | 944 | |||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The penetrance of the egg-laying defect in n1125 heterozygotes is heat-sensitive (especially at 25 C). See Table 7 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | As shown in Table 5, 11 percent of heterozygotes are Egl. Under homozygous conditions, 100 percent of hermaphrodites are Egl | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001340 | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | See Table 1 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 81 | 81 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 0.75 mg/ml imipramine | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0001068 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 7.5 mg/ml serotonin | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00001133 | ||||||||
Method | Substitution_allele |