WormBase Tree Display for Variation: WBVar00090149
expand all nodes | collapse all nodes | view schema
WBVar00090149 | Evidence | Paper_evidence | WBPaper00002518 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n1378 | ||||||
Other_name | CE17673:p.Gln569Ter | |||||||
F15C11.1.1:c.1705C>T | ||||||||
HGVSg | CHROMOSOME_I:g.7047462C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F15C11 | ||||
Flanking_sequences | ccaaaaaacgaaaatccactgcttgcaatg | aaaaaatgtgggcggagacagagccaccac | ||||||
Mapping_target | F15C11 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002518 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00027038 | |||||||
WBStrain00027039 | ||||||||
WBStrain00027045 | ||||||||
WBStrain00027050 | ||||||||
WBStrain00027268 | ||||||||
WBStrain00027281 | ||||||||
WBStrain00027282 | ||||||||
WBStrain00027293 | ||||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004773 | ||||||
Transcript | F15C11.1.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | F15C11.1.1:c.1705C>T | |||||||
HGVSp | CE17673:p.Gln569Ter | |||||||
cDNA_position | 1713 | |||||||
CDS_position | 1705 | |||||||
Protein_position | 569 | |||||||
Exon_number | 9/12 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
Genetics | Interpolated_map_position | I | 1.66236 | |||||
Mapping_data | In_multi_point | 1446 | ||||||
1447 | ||||||||
2089 | ||||||||
Description | Phenotype (9) | |||||||
Phenotype_not_observed | WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00006052 | |||||||
WBPaper00022358 | ||||||||
WBPaper00014018 | ||||||||
WBPaper00011119 | ||||||||
WBPaper00001105 | ||||||||
WBPaper00014234 | ||||||||
WBPaper00017445 | ||||||||
WBPaper00002518 | ||||||||
WBPaper00051369 | ||||||||
Method | Substitution_allele |