WormBase Tree Display for Variation: WBVar00090175
expand all nodes | collapse all nodes | view schema
WBVar00090175 | Evidence | Paper_evidence | WBPaper00006107 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n1456 | |||||||
Other_name (21) | |||||||||
HGVSg | CHROMOSOME_X:g.11018283C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F58A3 | |||||
Flanking_sequences | gaagacgaagaagaagactatagtgtttca | aaccggttgctccagatgcggggctcactg | |||||||
Mapping_target | F58A3 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00028774 | ||||||||
WBStrain00028775 | |||||||||
WBStrain00029366 | |||||||||
WBStrain00029367 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001184 | |||||||
Transcript (13) | |||||||||
Interactor | WBInteraction000500167 | ||||||||
WBInteraction000504727 | |||||||||
Genetics | Interpolated_map_position | X | 2.8543 | ||||||
Description | Phenotype | WBPhenotype:0000054 | Paper_evidence | WBPaper00006107 | |||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Lethality is rescued by the expression of EGL-15(5B) but not EGL-15(5A). | Paper_evidence | WBPaper00006107 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Class II, stronger allele than n484, putative null. :n1454, n1456, n1478 ( all larval lethal, L1 arrest). | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Null | Paper_evidence | WBPaper00006107 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000059 | Paper_evidence | WBPaper00036021 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Rescued by wild-type EGL-15 sequence and EGL-15 sequence with truncated CTD site (SEM-5 binding sites), which corresponds to the mutation in egl-15(n1457). | Paper_evidence | WBPaper00036021 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00036021 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000081 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000245 | Paper_evidence | WBPaper00036021 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Rescued by wild-type EGL-15 sequence but not by EGL-15 sequence with a truncated CTD site (with SEM-5 binding sites), which corresponds to the mutation in egl-15(n1457). | Paper_evidence | WBPaper00036021 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00036021 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Disease_info | Models_disease | DOID:0080001 | |||||||
Models_disease_in_annotation | WBDOannot00000565 | ||||||||
WBDOannot00000604 | |||||||||
Reference | WBPaper00006052 | ||||||||
WBPaper00006107 | |||||||||
WBPaper00018940 | |||||||||
WBPaper00036021 | |||||||||
Method | Substitution_allele |