WormBase Tree Display for Variation: WBVar00090183
expand all nodes | collapse all nodes | view schema
| WBVar00090183 | Evidence | Paper_evidence | WBPaper00006107 | |||||
|---|---|---|---|---|---|---|---|---|
| Name | Public_name | n1477 | ||||||
| Other_name (22) | ||||||||
| HGVSg | CHROMOSOME_X:g.11021423G>A | |||||||
| Sequence_details | SMap | S_parent | Sequence | F58A3 | ||||
| Flanking_sequences | ttttaaaacaatcgtagattatttggattg | atgttaacaatgacaaatgagactattgag | ||||||
| Mapping_target | F58A3 | |||||||
| Type_of_mutation | Substitution | g | a | |||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00027065 | |||||||
| WBStrain00027098 | ||||||||
| WBStrain00027152 | ||||||||
| WBStrain00028762 | ||||||||
| Laboratory | MT | |||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00001184 | ||||||
| Transcript (13) | ||||||||
| Interactor (150) | ||||||||
| Genetics | Interpolated_map_position | X | 2.85586 | |||||
| Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00006107 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| WBPhenotype:0000245 | Paper_evidence | WBPaper00006107 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | This mutation effects the EGL-15A splice form and results in posterior displaced SMs. | Paper_evidence | WBPaper00006107 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Phenotype_assay | Temperature | 15 | Paper_evidence | WBPaper00006107 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| WBPhenotype:0000314 | Paper_evidence | WBPaper00006107 | ||||||
| Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | |||||||
| Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00006107 | |||||
| Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | |||||||
| WBPhenotype:0000640 | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Class III allele. | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Phenotype_not_observed | WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||
| Curator_confirmed | WBPerson2987 | |||||||
| Remark | Table 1 | Paper_evidence | WBPaper00040284 | |||||
| Curator_confirmed | WBPerson2987 | |||||||
| Reference | WBPaper00040284 | |||||||
| WBPaper00026334 | ||||||||
| WBPaper00013863 | ||||||||
| WBPaper00006107 | ||||||||
| WBPaper00013708 | ||||||||
| WBPaper00026326 | ||||||||
| Method | Substitution_allele |
