WormBase Tree Display for Variation: WBVar00090348
expand all nodes | collapse all nodes | view schema
WBVar00090348 | Evidence | Paper_evidence | WBPaper00004503 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n2091 | |||||||
Other_name | CE30362:p.Cys136Tyr | ||||||||
Y47H9C.4c.1:c.407G>A | |||||||||
Y47H9C.4b.1:c.407G>A | |||||||||
CE30361:p.Cys136Tyr | |||||||||
CE20264:p.Cys136Tyr | |||||||||
Y47H9C.4a.1:c.407G>A | |||||||||
HGVSg | CHROMOSOME_I:g.11865938C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y47H9C | |||||
Flanking_sequences | aaaaaggaaaatgtattgagccgggaaaat | tgaatgtgatcccggttatggtggcaaata | |||||||
Mapping_target | Y47H9C | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004503 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000415 | |||||||
Transcript | Y47H9C.4a.1 (12) | ||||||||
Y47H9C.4c.1 (12) | |||||||||
Y47H9C.4b.1 (12) | |||||||||
Genetics | Interpolated_map_position | I | 12.8834 | ||||||
Description | Phenotype | WBPhenotype:0000241 | Paper_evidence | WBPaper00004503 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Cell corpses persisted in the L1 head. No cell corpses were observed in the wild-type L1 head. | Paper_evidence | WBPaper00004503 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00004503 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000885 | Paper_evidence | WBPaper00001438 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Failure to engulf cell corpses | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001438 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001438 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00004503 | ||||||||
WBPaper00001438 | |||||||||
Method | Substitution_allele |