WormBase Tree Display for Variation: WBVar00090651
expand all nodes | collapse all nodes | view schema
| WBVar00090651 | Evidence | Paper_evidence | WBPaper00003888 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | n3066 | |||||
| Other_name | T09A5.10.2:c.1615C>T | ||||||
| CE18951:p.Gln539Ter | |||||||
| T09A5.10.1:c.1615C>T | |||||||
| HGVSg | CHROMOSOME_II:g.7862368C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | T09A5 | |||
| Flanking_sequences | gcgtgcaagagtaaggacgatatcatcaaattt | aagaggagcagaacaaacgagctgccaatc | |||||
| Mapping_target | T09A5 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003888 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00034598 | ||||||
| Laboratory | MT | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00002994 | |||||
| Transcript | T09A5.10.2 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | T09A5.10.2:c.1615C>T | ||||||
| HGVSp | CE18951:p.Gln539Ter | ||||||
| cDNA_position | 1616 | ||||||
| CDS_position | 1615 | ||||||
| Protein_position | 539 | ||||||
| Exon_number | 4/8 | ||||||
| Codon_change | Caa/Taa | ||||||
| Amino_acid_change | Q/* | ||||||
| T09A5.10.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | T09A5.10.1:c.1615C>T | ||||||
| HGVSp | CE18951:p.Gln539Ter | ||||||
| cDNA_position | 1701 | ||||||
| CDS_position | 1615 | ||||||
| Protein_position | 539 | ||||||
| Exon_number | 4/8 | ||||||
| Codon_change | Caa/Taa | ||||||
| Amino_acid_change | Q/* | ||||||
| Genetics | Interpolated_map_position | II | 0.58696 | ||||
| Reference | WBPaper00003888 | ||||||
| Remark | [180111 pad] The published data has a discrepancy in that the Q labelled in the protein diagram is at position 542 and not after amino acid 538 as discussed in the Results section. Corrected the annotation to use this alternative Q at position 539 which follows the single point mutation c > t for the ochre STOP variant. | Person_evidence | WBPerson8364 | ||||
| Curator_confirmed | WBPerson1983 | ||||||
| Method | Substitution_allele |
