WormBase Tree Display for Variation: WBVar00090676
expand all nodes | collapse all nodes | view schema
WBVar00090676 | Evidence | Paper_evidence | WBPaper00005190 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | n3264 | |||||
Other_name (11) | |||||||
HGVSg | CHROMOSOME_III:g.7589505G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | R13A5 | |||
Flanking_sequences | tcatgacgtgtgccattgtactttacgctg | tttcttgattgccggatgggttattattgg | |||||
Mapping_target | R13A5 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005190 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | MT | ||||||
Status | Live | ||||||
Affects (2) | |||||||
Genetics | Interpolated_map_position | III | -0.663209 | ||||
Description | Phenotype | WBPhenotype:0000243 | Paper_evidence | WBPaper00005190 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | n3264 was isolated in a screen for mutants defective in cell-corpse engulfment (Z. Zhou and H.R.H., unpublished data). | Paper_evidence | WBPaper00005190 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00005190 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | A secreted GFP expressed under the control of the myo-3 promoter normally is diffuse through the C. elegans pseudocoelom but accumulated in the coelomocytes of cup-5(n3264) animals (data not shown). | Paper_evidence | WBPaper00005190 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002089 | Paper_evidence | WBPaper00005190 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Cells in mutants were disorganized and displayed irregular morphologies. Specifically, cup-5 mutant animals contained many cells with enlarged vacuoles or lysosomes and membranous lamellar structures that are not seen in wild-type animals. | Paper_evidence | WBPaper00005190 | ||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005190 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002234 | Paper_evidence | WBPaper00005190 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Mutants accumulated LysoTracker Red in most and possibly all tissues of the embryo. Mutants did not have excess intestinal cells that might have been responsible for the broader distribution of LysoTracker. Furthermore, mutants showed normal distribution of the mitochondrial marker MitoTracker Red. Mutant animals contain excess acidified intracellular compartments that most likely are lysosomes. | Paper_evidence | WBPaper00005190 | ||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005190 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002368 | Paper_evidence | WBPaper00005190 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | n3264 does cause accumulation of refractile bodies in embryos. | Paper_evidence | WBPaper00005190 | ||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_not_observed | WBPhenotype:0000052 | Paper_evidence | WBPaper00005190 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | This mutant failed to complement n3194 for maternal-effect lethality; however, it does not confer a maternal-effect lethal phenotype on its own; n3264 seems to be a partial loss-of-function allele. | Paper_evidence | WBPaper00005190 | ||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005190 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00005190 | ||||||
Method | Substitution_allele |