WormBase Tree Display for Variation: WBVar00090702
expand all nodes | collapse all nodes | view schema
WBVar00090702 | Evidence | Paper_evidence | WBPaper00032217 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n3412 | ||||||
Other_name | Y16B4A.1.1:c.927G>A | |||||||
CE29366:p.Trp309Ter | ||||||||
HGVSg | CHROMOSOME_X:g.14781635G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F42D1 | ||||
Flanking_sequences | agttgcttttggcacagcaagtccgaactg | ggagaggtaattttctattatctggaggga | ||||||
Mapping_target | F42D1 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin (3) | ||||||||
Affects | Gene | WBGene00006743 | ||||||
Transcript | Y16B4A.1.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y16B4A.1.1:c.927G>A | |||||||
HGVSp | CE29366:p.Trp309Ter | |||||||
cDNA_position | 980 | |||||||
CDS_position | 927 | |||||||
Protein_position | 309 | |||||||
Exon_number | 9/14 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
Genetics | Interpolated_map_position | X | 21.3236 | |||||
Description | Phenotype | WBPhenotype:0000643 | Paper_evidence | WBPaper00032217 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Uncoordinated movement is indistinguishable from that of e151 or n3435. | Paper_evidence | WBPaper00032217 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032217 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | Plin-11::GFP | Paper_evidence | WBPaper00032217 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002508 | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals have four extra fluorescent neurons in the ventral nerve cord of adults as compared to wild-type animals. | Paper_evidence | WBPaper00032217 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032217 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | Plin-11::GFP | Paper_evidence | WBPaper00032217 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00032217 | |||||||
Method | Substitution_allele |