WormBase Tree Display for Variation: WBVar00090748
expand all nodes | collapse all nodes | view schema
WBVar00090748 | Evidence | Paper_evidence | WBPaper00013412 | ||||
---|---|---|---|---|---|---|---|
WBPaper00027336 | |||||||
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | VC5 | |||
Flanking_sequences | tatgaactctcgaaaattgaacagaagaca | gatcacccgaaaaaccactatcagatttgg | |||||
Mapping_target | VC5 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00027336 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00027398 | ||||||
Laboratory | MT | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00007029 | |||||
Transcript | VC5.4.1 (12) | ||||||
Interactor | WBInteraction000503733 | ||||||
Genetics | Interpolated_map_position | V | 0.546172 | ||||
Reference | WBPaper00027336 | ||||||
WBPaper00013412 | |||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00007029 Missense 341 G to R | Person_evidence | WBPerson31184" | ||||
WBPerson31184 | |||||||
Method | Substitution_allele |