WormBase Tree Display for Variation: WBVar00090772
expand all nodes | collapse all nodes | view schema
| WBVar00090772 | Evidence | Paper_evidence | WBPaper00005540 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | n3790 | |||||
| HGVSg | CHROMOSOME_IV:g.8360535_8363244del | ||||||
| Sequence_details | SMap | S_parent | Sequence | D2096 | |||
| Flanking_sequences | accccagataactgaagttttgtatatgca | cacagtctattttccgctttcatgttgtat | |||||
| Mapping_target | D2096 | ||||||
| Type_of_mutation | Deletion | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | MT | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00005019 | |||||
| Transcript | D2096.4b.1 | VEP_consequence | transcript_ablation | ||||
| VEP_impact | HIGH | ||||||
| Intron_number | 1-4/4 | ||||||
| Exon_number | 1-5/5 | ||||||
| D2096.4a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,3_prime_UTR_variant,intron_variant | |||||
| VEP_impact | HIGH | ||||||
| cDNA_position | ?-1649 | ||||||
| Intron_number | 2-6/7 | ||||||
| Exon_number | 1-8/8 | ||||||
| Isolation | Mutagen | UV illumination and trimethylpsoralen | Paper_evidence | WBPaper00005540 | |||
| Genetics | Interpolated_map_position | IV | 3.71374 | ||||
| Description | Phenotype | WBPhenotype:0000052 | Paper_evidence | WBPaper00005540 | |||
| Curator_confirmed | WBPerson282 | ||||||
| WBPhenotype:0000510 | Paper_evidence | WBPaper00005540 | |||||
| Curator_confirmed | WBPerson282 | ||||||
| Remark | Extracellular space between vulval cells reduced during L4 stage. | Paper_evidence | WBPaper00005540 | ||||
| Curator_confirmed | WBPerson282 | ||||||
| WBPhenotype:0001078 | Paper_evidence | WBPaper00005540 | |||||
| Curator_confirmed | WBPerson282 | ||||||
| Remark | Maternal WT copy of the gene rescues this phenotype. | Paper_evidence | WBPaper00005540 | ||||
| Curator_confirmed | WBPerson282 | ||||||
| WBPhenotype:0001523 | Paper_evidence | WBPaper00005540 | |||||
| Curator_confirmed | WBPerson282 | ||||||
| Remark | Extracellular space between cell and eggshell reduced at 1-cell stage. Extracellular space between vulval cells reduced during L4 stage. | Paper_evidence | WBPaper00005540 | ||||
| Curator_confirmed | WBPerson282 | ||||||
| Reference | WBPaper00005540 | ||||||
| Method | Deletion_allele |
