WormBase Tree Display for Variation: WBVar00090812
expand all nodes | collapse all nodes | view schema
| WBVar00090812 | Evidence | Paper_evidence | WBPaper00030864 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | n4256 | |||||
| Other_name | CE47959:p.Arg297PhefsTer37 | ||||||
| R05D3.11.1:c.888_1659del | |||||||
| HGVSg | CHROMOSOME_III:g.8376303_8377645del | ||||||
| Sequence_details | SMap | S_parent | Sequence | R05D3 | |||
| Flanking_sequences | agcaattctcatgctcactctgattcgatt | attttcttcgacaacggaaccgatgcatac | |||||
| Mapping_target | R05D3 | ||||||
| Type_of_mutation | Deletion | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain (12) | |||||||
| Component_of_genotype | WBGenotype00000092 | ||||||
| Laboratory | MT | ||||||
| ZAS | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00019883 | |||||
| Transcript | R05D3.11.1 (11) | ||||||
| Interactor | WBInteraction000501282 | ||||||
| WBInteraction000501286 | |||||||
| WBInteraction000502976 | |||||||
| WBInteraction000503732 | |||||||
| WBInteraction000520947 | |||||||
| WBInteraction000521434 | |||||||
| WBInteraction000523955 | |||||||
| WBInteraction000541390 | |||||||
| WBInteraction000565327 | |||||||
| WBInteraction000578998 | |||||||
| Genetics | Interpolated_map_position | III | -0.275514 | ||||
| Description | Phenotype (11) | ||||||
| Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00040176 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | The number of CED-1::GFP(+) nuclei was not significantly affected in mutant germ lines. | Paper_evidence | WBPaper00040176 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000313 | Paper_evidence | WBPaper00044637 | |||||
| Curator_confirmed | WBPerson22699 | ||||||
| WBPhenotype:0000700 | Paper_evidence | WBPaper00038257 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Worms with pseudovulvaes were not detected with considerablefrequency for met-2 even at elevated temperature. | Paper_evidence | WBPaper00038257 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000730 | Paper_evidence | WBPaper00040176 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Germline apoptosis was not significantly affected in mutants. | Paper_evidence | WBPaper00040176 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Disease_info | Modifies_disease | DOID:332 | |||||
| DOID:9255 | |||||||
| Modifies_disease_in_annotation | WBDOannot00001122 | ||||||
| WBDOannot00001123 | |||||||
| Reference (13) | |||||||
| Method | Deletion_allele |
