WormBase Tree Display for Variation: WBVar00090821
expand all nodes | collapse all nodes | view schema
| WBVar00090821 | Evidence | Paper_evidence | WBPaper00027681 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | n4295 | |||||
| Other_name (12) | |||||||
| HGVSg | CHROMOSOME_II:g.14406038_14407115del | ||||||
| Sequence_details | SMap | S_parent | Sequence | F26H11 | |||
| Flanking_sequences | TTTCCGTATTTGTGGCGACCACTGTTTGTTGAACATATCGCGTCGTTTAT | CTACGAGTCGGAAGCGTCAGATGTGTCGGGTTCGAGTCGTGTTAGTGTGC | |||||
| Mapping_target | F26H11 | ||||||
| Type_of_mutation | Deletion | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00027435 | ||||||
| WBStrain00031098 | |||||||
| Laboratory | MT | ||||||
| Status | Live | Curator_confirmed | WBPerson4025 | ||||
| Affects | Gene | WBGene00009180 | |||||
| Transcript (12) | |||||||
| Isolation | Mutagen | EMS | Paper_evidence | WBPaper00027681 | |||
| Genetics | Interpolated_map_position | II | 22.9664 | ||||
| Description | Phenotype_not_observed | WBPhenotype:0000886 | Person_evidence | WBPerson566 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Grossly wild-type.Specifically affects the nurf-1b through e isoforms, but not the nurf-1a isoform. Described in Andersen, Lu, and Horvitz (WBPaper00027681). | Person_evidence | WBPerson566 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Null | Person_evidence | WBPerson566 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00027681 | ||||||
| Remark | This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf898233 | ||||
| This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | |||||
| Method | Deletion_allele |
