WormBase Tree Display for Variation: WBVar00090864
expand all nodes | collapse all nodes | view schema
WBVar00090864 | Evidence | Paper_evidence | WBPaper00035439 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n4562 | ||||||
Other_name | Y116A8C.32a.1:c.1374T>A | |||||||
CE28108:p.Cys458Ter | ||||||||
HGVSg | CHROMOSOME_IV:g.17105977A>T | |||||||
Sequence_details | SMap | S_parent | Sequence | Y116A8C | ||||
Flanking_sequences | acaatcctttgaaatatgaccaaatgctcc | caatttgtacattttatttgatttgtcaca | ||||||
Mapping_target | Y116A8C | |||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00027479 | |||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00013808 | ||||||
Transcript | Y116A8C.32a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y116A8C.32a.1:c.1374T>A | |||||||
HGVSp | CE28108:p.Cys458Ter | |||||||
cDNA_position | 1374 | |||||||
CDS_position | 1374 | |||||||
Protein_position | 458 | |||||||
Exon_number | 7/9 | |||||||
Codon_change | tgT/tgA | |||||||
Amino_acid_change | C/* | |||||||
Genetics | Interpolated_map_position | IV | 16.1547 | |||||
Description | Phenotype | WBPhenotype:0000688 | Paper_evidence | WBPaper00035439 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | n4562 causes sterility at all temperatures | Paper_evidence | WBPaper00035439 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00035439 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035439 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035439 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_not_observed | WBPhenotype:0001807 | Paper_evidence | WBPaper00035439 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | sfa-1(n4562) does not cause obvious alternative splicing of the sup-10 and unc-93 transcripts | Paper_evidence | WBPaper00035439 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035439 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035439 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | RT-PCR | Paper_evidence | WBPaper00035439 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00035439 | |||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | |||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | ||||||
Method | Substitution_allele |