WormBase Tree Display for Variation: WBVar00090918
expand all nodes | collapse all nodes | view schema
WBVar00090918 | Evidence | Paper_evidence | WBPaper00035439 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | n5222 | |||||
HGVSg | CHROMOSOME_III:g.1075349_1076644del | ||||||
Sequence_details | SMap | S_parent | Sequence | Y92C3B | |||
Flanking_sequences | gctcacaggagcacatttgaccactttcccg | tgtccaaaaaaccgcaaaaaatcgattttc | |||||
Mapping_target | Y92C3B | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | MT | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006697 | |||||
WBGene00305916 | |||||||
Transcript | Y92C3B.2a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
Intron_number | 1/7 | ||||||
Exon_number | 1/8 | ||||||
Y92C3B.5 | |||||||
Genetics | Interpolated_map_position | III | -24.5506 | ||||
Description | Phenotype | WBPhenotype:0000055 | Paper_evidence | WBPaper00035439 | |||
Curator_confirmed | WBPerson2021 | ||||||
Remark | uaf-1(n5222) homozygous mutants arrested at the late L1 to early L2 larval stages | Paper_evidence | WBPaper00035439 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Recessive | Paper_evidence | WBPaper00035439 | |||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000057 | Paper_evidence | WBPaper00035439 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | uaf-1(n5222) homozygous mutants died at the late L1 to early L2 larval stages | Paper_evidence | WBPaper00035439 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Recessive | Paper_evidence | WBPaper00035439 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00035439 | ||||||
Method | Deletion_allele |