WormBase Tree Display for Variation: WBVar00090952
expand all nodes | collapse all nodes | view schema
| WBVar00090952 | Evidence | Paper_evidence | WBPaper00005257 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | nc37 | |||||
| HGVSg | CHROMOSOME_IV:g.957334_964947del | ||||||
| Sequence_details | SMap | S_parent | Sequence | Y55F3AL | |||
| Flanking_sequences | atatcctaaaaattgaccgaaatatgagtt | ccccgggttacggtagttttcgtggtggga | |||||
| Mapping_target | Y55F3AL | ||||||
| Type_of_mutation | Deletion | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00034115 | ||||||
| WBStrain00034116 | |||||||
| WBStrain00034117 | |||||||
| WBStrain00034487 | |||||||
| Laboratory | ST | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00004047 | |||||
| Transcript | Y55F3AL.1d.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| Intron_number | 1/20 | ||||||
| Exon_number | 1/21 | ||||||
| Y55F3AL.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
| VEP_impact | HIGH | ||||||
| Intron_number | 1-4/24 | ||||||
| Exon_number | 1-4/25 | ||||||
| Y55F3AL.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
| VEP_impact | HIGH | ||||||
| Intron_number | 1-4/24 | ||||||
| Exon_number | 1-4/25 | ||||||
| Y55F3AL.1c.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
| VEP_impact | HIGH | ||||||
| Intron_number | 1/20 | ||||||
| Exon_number | 1/21 | ||||||
| Interactor | WBInteraction000009103 | ||||||
| WBInteraction000009104 | |||||||
| WBInteraction000503587 | |||||||
| WBInteraction000536195 | |||||||
| WBInteraction000536198 | |||||||
| WBInteraction000536199 | |||||||
| WBInteraction000536202 | |||||||
| Genetics | Interpolated_map_position | IV | -22.905 | ||||
| Description | Phenotype | WBPhenotype:0000298 | Paper_evidence | WBPaper00031002 | |||
| WBPaper00031700 | |||||||
| Curator_confirmed | WBPerson557 | ||||||
| WBPerson2987 | |||||||
| Remark | "In wild-type adults, ray 1, the anterior-most ray, is mostly found juxtaposed to its neighboring ray 2 ("Level 1" phenotype) (Fig 1A). In contrast, in plx-1(nc37, ev724) single and smp-1(ev715) smp-2(ev709) double mutant adults, ray 1 is frequently displaced anteriorly (Fig 1B,C). The displaced ray 1 is often found outside of a fan ("Level 3" phenotype), and in some cases ray 1 is separate from ray 2 within a fan ("Level 2" phenotype) (see Supplemental Fig S1 for examples of the three levels)." (Supplemental Table S1) | Paper_evidence | WBPaper00031700 | ||||
| Curator_confirmed | WBPerson2987 | ||||||
| Phenotype_not_observed | WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Reference | WBPaper00031002 | ||||||
| WBPaper00032446 | |||||||
| WBPaper00031700 | |||||||
| WBPaper00011954 | |||||||
| Method | Deletion_allele |
