WormBase Tree Display for Variation: WBVar00090978

WBVar00090978 Evidence: Paper_evidence: WBPaper00026975
  Name: Public_name: ne411
    Other_name: C09G9.6.1:c.719C>T
      CE03005:p.Pro240Leu
    HGVSg: CHROMOSOME_IV:g.8889984C>T
  Sequence_details: SMap: S_parent: Sequence: C27B7
    Flanking_sequences: ctttagaaatgtttgccaggccatcaactc agatgagccagcggctaaattgccactagg
    Mapping_target: C27B7
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00026975
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00040433
    Laboratory: WM
    Status: Live
  Affects: Gene: WBGene00003864
    Transcript: C09G9.6.1 (12)
    Interactor: WBInteraction000502270
  Genetics: Interpolated_map_position: IV 3.99916
  Description: Phenotype: WBPhenotype:0001351 Paper_evidence: WBPaper00026975
        Curator_confirmed: WBPerson2987
        Remark: "Importantly, the proline to leucine change (P240L) found in the oma-1 gain-of-function mutants (zu405 and ne411) also prevented phosphorylation at T239 (Figure 5B)." Paper_evidence: WBPaper00026975
            Curator_confirmed: WBPerson2987
      WBPhenotype:0001645 Paper_evidence: WBPaper00026975
        Curator_confirmed: WBPerson2987
        Remark: "In par-1 mutants, GFP::ZF1 protein is expressed uniformly in all blastomeres until the 2-cell stage but is degraded rapidly when the embryo divides from two to four cells. This degradation is dependent on ZIF-1. We found that in gsk-3(RNAi), cdk-1(ne2257), and oma-1(ne411gf) mutants, the GFP::ZF1 signal remains high from the 4- to 8-cell stage (Figure 6A), suggesting that stabilized OMA-1 interferes with ZIF-1-dependent proteolysis." Paper_evidence: WBPaper00026975
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: par-1(RNAi) Paper_evidence: WBPaper00026975
              Curator_confirmed: WBPerson2987
  Reference: WBPaper00026975
  Method: Substitution_allele