WormBase Tree Display for Variation: WBVar00090999
expand all nodes | collapse all nodes | view schema
WBVar00090999 | Evidence | Paper_evidence | WBPaper00026736 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ne1991 | |||||||
Other_name (12) | |||||||||
HGVSg | CHROMOSOME_III:g.13720204T>C | ||||||||
Sequence_details | SMap | S_parent | Sequence | W06F12 | |||||
Flanking_sequences | gtaagcgagtgtttcgagaaatcaaaatgc | cagctcattccgacatgacaacgttctctc | |||||||
Mapping_target | W06F12 | ||||||||
Type_of_mutation | Substitution | t | c | Paper_evidence | WBPaper00026736 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00040429 | ||||||||
Laboratory | WM | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003048 | |||||||
Transcript | W06F12.1a.1 (12) | ||||||||
W06F12.1c.1 (12) | |||||||||
W06F12.1b.1 (12) | |||||||||
W06F12.1e.1 (12) | |||||||||
W06F12.1d.2 (12) | |||||||||
W06F12.1d.1 (12) | |||||||||
W06F12.1d.3 (12) | |||||||||
Interactor | WBInteraction000502189 | ||||||||
WBInteraction000519778 | |||||||||
WBInteraction000542275 | |||||||||
WBInteraction000542276 | |||||||||
Genetics | Interpolated_map_position | III | 21.3994 | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00026736 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants have defects in P2/EMS signaling | Paper_evidence | WBPaper00026736 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00026736 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00026736 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00026736 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00026736 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | WRM-1 levels were absent in the E nucleus. In lit-1 mutants, the GFP signal was strongly excluded from the nucleus in all cells in the early embryo. This nuclear exclusion was not dependent on IMB-4 | Paper_evidence | WBPaper00026736 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0001975 | PATO:0000460 | Paper_evidence | WBPaper00026736 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0001001 | PATO:0000460 | Paper_evidence | WBPaper00026736 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000071 | PATO:0000460 | Paper_evidence | WBPaper00026736 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000007 | PATO:0000460 | Paper_evidence | WBPaper00026736 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000008 | PATO:0000460 | Paper_evidence | WBPaper00026736 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00026736 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | lit-1 mutants carrying the WRM-1::GFP transgene were examined. Nuclear retention was assayed by subjecting the animals to imb-4 RNAi | Paper_evidence | WBPaper00026736 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 25C | Paper_evidence | WBPaper00026736 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | neIs2 [WRM-1::GFP] | Paper_evidence | WBPaper00026736 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00045459 | |||||||
Curator_confirmed | WBPerson15416 | ||||||||
Remark | Figure 5, POPTOP reporter expression increased in L4 hermaphrodite somatic gonad | Paper_evidence | WBPaper00045459 | ||||||
Curator_confirmed | WBPerson15416 | ||||||||
Reference | WBPaper00026736 | ||||||||
WBPaper00045459 | |||||||||
Method | Substitution_allele |