WormBase Tree Display for Variation: WBVar00091303
expand all nodes | collapse all nodes | view schema
WBVar00091303 | Evidence | Person_evidence | WBPerson499 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | np1 | |||||||
HGVSg | CHROMOSOME_I:g.4569218_4570570delinsAGCGAAC | ||||||||
Sequence_details | SMap | S_parent | Sequence | D1007 | |||||
Flanking_sequences | TAAACTACAGAAGTTCGCTTTTGGA | TACCACATTCACATCAGGACAACTGAAG | |||||||
Mapping_target | D1007 | ||||||||
Type_of_mutation | Insertion | AGTTCGCT | Author_evidence | Mara Andrione | |||||
Deletion | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00000440 | |||||||
Transcript | D1007.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
cDNA_position | ?-461 | ||||||||
CDS_position | ?-458 | ||||||||
Protein_position | ?-153 | ||||||||
Intron_number | 2-3/4 | ||||||||
Exon_number | 1-4/5 | ||||||||
Interactor (18) | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Genetics | Interpolated_map_position | I | -1.04587 | ||||||
Mapping_data | In_multi_point | 4204 | |||||||
Description | Phenotype (11) | ||||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00036308 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The ceh-17(np1) null mutant exhibits no change in expression of the unc-119::YFP transgene in the ALA neuron (Table 2) | Paper_evidence | WBPaper00036308 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
The ceh-17(np1) null mutant exhibits no change in expression of the rab-3::GFP transgene in the ALA neuron (Table 2) | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"To determine whether CEH-10 and CEH-14 also play roles in ALA axon migration, we examined unc-53:GFP (pNP21; N. Pujol), which labels several neurons including ALA and the DA neurons of the ventral cord that extend commissural axons, marking body length (Stringham et al., 2002). In wild-type animals this reporter labels the ALA axons during the L1-L2 stages. We first examined unc-53:GFP in ALA in ceh-17(null) and ceh-10(rf) L1-L2 animals and found that expression of the reporter was not detectably impaired (Fig 6A)." | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003955 | PATO:0000460 | Paper_evidence | WBPaper00036308 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | unc-119::YFP | Paper_evidence | WBPaper00036308 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
rab-3::GFP | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
unc-53:GFP | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000424 | Paper_evidence | WBPaper00004283 | |||||||
Curator_confirmed | WBPerson499 | ||||||||
Remark | a FRMFamide-like reactivity is normally detected in ALA (Schinkmann and Li, 1992) and the vesicular acetylcholine transporter (VAChT) encoded by unc-17 (Alfonso et al., 1993) is expressed in SIAs (J. Duerr, personal communication). Expression of these markers was unaffected in ceh-17 mutants (see Materials and Methods and data not shown). | Paper_evidence | WBPaper00004283 | ||||||
Curator_confirmed | WBPerson499 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003955 | PATO:0000460 | Paper_evidence | WBPaper00004283 | ||||
Curator_confirmed | WBPerson499 | ||||||||
WBbt:0005361 | PATO:0000460 | Paper_evidence | WBPaper00004283 | ||||||
Curator_confirmed | WBPerson499 | ||||||||
WBPhenotype:0001310 | Paper_evidence | WBPaper00036308 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that similar to ceh-17 animals, the ALA neuron is present and its cell body is positioned normally (Fig 1A, DIC images) but the ceh-14(ch3) null mutant animals are completely resistant to the behavioral effects of EGF expression (Table 1)." | Paper_evidence | WBPaper00036308 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003955 | PATO:0000460 | Paper_evidence | WBPaper00036308 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00031936 | ||||||||
WBPaper00004283 | |||||||||
WBPaper00036308 | |||||||||
WBPaper00050011 | |||||||||
WBPaper00050371 | |||||||||
WBPaper00050847 | |||||||||
WBPaper00056066 | |||||||||
WBPaper00057148 | |||||||||
WBPaper00059734 | |||||||||
WBPaper00064927 | |||||||||
Remark | Updated the context of this variation to reflect a reported Insertion of 8bp at the deletion site in the ZIM lab isolate. | Author_evidence | Mara Andrione | ||||||
Curator_confirmed | WBPerson1983 | ||||||||
Method | Deletion_and_insertion_allele |