WormBase Tree Display for Variation: WBVar00091417
expand all nodes | collapse all nodes | view schema
WBVar00091417 | Name | Public_name | nu199 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C09E10.2b.1:c.964+1G>A | |||||||
C09E10.2e.1:c.865+1G>A | ||||||||
C09E10.2d.1:c.840+325G>A | ||||||||
C09E10.2c.1:c.834+325G>A | ||||||||
C09E10.2a.1:c.958+1G>A | ||||||||
HGVSg | CHROMOSOME_X:g.988608C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C09E10 | ||||
Flanking_sequences | gatattatattactcaagtggtcggcgagg | taagcctgaccgcgtacgaataatttattc | ||||||
Mapping_target | C09E10 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003697 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | KP | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000958 | ||||||
Transcript | C09E10.2d.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | C09E10.2d.1:c.840+325G>A | |||||||
Intron_number | 6/13 | |||||||
C09E10.2c.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | C09E10.2c.1:c.834+325G>A | |||||||
Intron_number | 6/13 | |||||||
C09E10.2a.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C09E10.2a.1:c.958+1G>A | |||||||
Intron_number | 8/17 | |||||||
C09E10.2e.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C09E10.2e.1:c.865+1G>A | |||||||
Intron_number | 6/14 | |||||||
C09E10.2b.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C09E10.2b.1:c.964+1G>A | |||||||
Intron_number | 8/17 | |||||||
Interactor | WBInteraction000555812 | |||||||
Genetics | Interpolated_map_position | X | -18.8704 | |||||
Description | Phenotype | WBPhenotype:0001468 | Paper_evidence | WBPaper00032215 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited enhanced attraction to benzaldehyde compared to wild type. | Paper_evidence | WBPaper00032215 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00002087 | Paper_evidence | WBPaper00032215 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001469 | Paper_evidence | WBPaper00032215 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited enhanced attraction to butanone compared to wild type. | Paper_evidence | WBPaper00032215 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00005086 | Paper_evidence | WBPaper00032215 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed (3) | ||||||||
Reference | WBPaper00004721 | |||||||
WBPaper00003697 | ||||||||
WBPaper00032215 | ||||||||
Method | Substitution_allele |