WormBase Tree Display for Variation: WBVar00091688
expand all nodes | collapse all nodes | view schema
WBVar00091688 | Name | Public_name | ok393 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F28H6.1a.1:c.724-42_1243del | ||||||||
F28H6.1b.1:c.724-42_1243del | |||||||||
HGVSg | CHROMOSOME_X:g.14150221_14150939del | ||||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_X | |||||
Flanking_sequences | tcttacttacaattatttaaaatatttgaa | gggtcccagctaagcggcttggtgccggtc | |||||||
Mapping_target | CHROMOSOME_X | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | OK393_external | ||||||||
OK393_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00035581 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000103 | |||||||
Transcript | F28H6.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F28H6.1a.1:c.724-42_1243del | ||||||||
cDNA_position | ?-1250 | ||||||||
CDS_position | ?-1243 | ||||||||
Protein_position | ?-415 | ||||||||
Intron_number | 6-8/10 | ||||||||
Exon_number | 7-9/11 | ||||||||
F28H6.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F28H6.1b.1:c.724-42_1243del | ||||||||
cDNA_position | ?-1250 | ||||||||
CDS_position | ?-1243 | ||||||||
Protein_position | ?-415 | ||||||||
Intron_number | 6-8/9 | ||||||||
Exon_number | 7-9/10 | ||||||||
Interactor (12) | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Genetics | Mapping_data | In_multi_point | 4152 | ||||||
Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00036474 | |||||
WBPaper00045812 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Both akt-1(ok525) and akt-2(ok393) mutants showed a reproducible increase in lifespan relative to wild type (Fig 3g and Supplementary Table 1)." | Paper_evidence | WBPaper00036474 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"Mutation in akt-2 exhibited greater lifespan extension of daf-16(mgDf50); daf-16a transgenic animals than a mutation in akt-1 (Fig 3h and Supplementary Table 1)." | Paper_evidence | WBPaper00036474 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"... consistent with the DAF-16 nuclear translocation data, mutation in akt-1 resulted in a larger increase in lifespan of daf-16(mgDf50); daf-16d/f transgenic animals when compared with a mutation in akt-2 (Fig 3i and Supplementary Table 1)." | Paper_evidence | WBPaper00036474 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Table S1 | Paper_evidence | WBPaper00045812 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | daf-16(mgDf50); DAF-16a::GFP | Paper_evidence | WBPaper00036474 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
daf-16(mgDf50); DAF-16d/f::GFP | Paper_evidence | WBPaper00036474 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000731 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | akt-2 loss-of-function mutants exhibited increased sensitivity to DNA-damage-induced germ-cell apoptosis 12, 24, and 36 hr after irradiation | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006796 | PATO:0000460 | Paper_evidence | WBPaper00029085 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00029085 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Treated with 60 Gy IR | Paper_evidence | WBPaper00029085 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001781 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | ENU caused a significant increase in germline apoptosis in akt-1 and akt-2 loss of- function mutants | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006796 | PATO:0000460 | Paper_evidence | WBPaper00029085 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00029085 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Treated with 5mM ENU | Paper_evidence | WBPaper00029085 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001999 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The integration of signals for attraction to diacetyl (100x dilute) and avoidance from copper (100 millimolar) was impaired in akt-2(ok393) insulin-like signaling pathway mutants, resulting in more animals crossing the copper barrier to get to the diacetyl spot than in wild type controls (Figure 1C) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBMol:00002819 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000308 | Paper_evidence | WBPaper00036472 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | akt-2 mutants did not undergo significant dauer arrest at 25C or 27C on standard NGM plates containing cholesterol, similar to wildtype | Paper_evidence | WBPaper00036472 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00036472 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Localization of the synaptic protein SNB-1 is normal, based on transgene expression analysis. | Paper_evidence | WBPaper00028886 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000481 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutant animals did not display an abnormal aversion response to copper, compared to wild type animals (Figure 2B) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000730 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | None of the akt mutants affected developmental apoptosis | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000885 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | None of the akt mutants affected the engulfment rates of the germ-cell corpses | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001470 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutants exhibited no change in chemotaxis towards diacetyl, compared to wild type controls (Figure 2A) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002819 | Paper_evidence | WBPaper00037970 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00037970 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutant animals exhibit a wild type frequency of body bends (Figure 3A) | Paper_evidence | WBPaper00037970 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00037970 | ||||||||
WBPaper00028886 | |||||||||
WBPaper00029085 | |||||||||
WBPaper00036472 | |||||||||
WBPaper00036474 | |||||||||
WBPaper00045812 | |||||||||
Remark | Last updated on 29 Nov 2002 | ||||||||
Knockout originally requested for F28H6.1 before it was renamed to F28H6.1a | |||||||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||||
Method | KO_consortium_allele |