WormBase Tree Display for Variation: WBVar00091750
expand all nodes | collapse all nodes | view schema
WBVar00091750 | Evidence | Paper_evidence | WBPaper00006537 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok459 | ||||||
HGVSg | CHROMOSOME_I:g.6183355_6184776del | |||||||
Sequence_details | SMap | S_parent | Sequence | T09B4 | ||||
Flanking_sequences | ctggagcgttctgaaaccacaattccgttt | cataatattttatgtttaaataacttttta | ||||||
Mapping_target | T09B4 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok459_external | |||||||
ok459_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00035717 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects (2) | ||||||||
Isolation | Mutagen | UV/TMP | ||||||
Genetics | Mapping_data | In_multi_point | 4217 | |||||
Description | Phenotype | WBPhenotype:0000062 | Paper_evidence | WBPaper00006537 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 25% (n=120) of the heat shocked CHIP (-/-)nematode larvae were dead (no movement at all). On the other hand, 100% (n=530) of heat shocked control animals (wild type) were alive (contract pharynx and thrash body). 4.9% (n=121) of the CHIP (-/-) larvae grown at 20 C (optimum growth temperature) were also dead (no movement at all). | Paper_evidence | WBPaper00006537 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00006537 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000081 | Paper_evidence | WBPaper00006537 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The homozygous ok459 larvae arrested at L1 stage. | Paper_evidence | WBPaper00006537 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000273 | Paper_evidence | WBPaper00006537 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Body thrashing rates of mutants are very low compared to wild type animals. | Paper_evidence | WBPaper00006537 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000641 | Paper_evidence | WBPaper00006537 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | ok459 animals were either lethargic or unable to move. | Paper_evidence | WBPaper00006537 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000747 | Paper_evidence | WBPaper00006537 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | ok459 animals were completely unable to contract pharynx. | Paper_evidence | WBPaper00006537 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001482 | Paper_evidence | WBPaper00006537 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | ok459 animals bend their body occasionally. | Paper_evidence | WBPaper00006537 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001983 | Paper_evidence | WBPaper00006537 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | ok459 animals do not exhibit exploratory behavior. | Paper_evidence | WBPaper00006537 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000709 | Paper_evidence | WBPaper00006537 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The gross morphology of the pharynx of ok459 animals was seen like wild type animal (data not shown). | Paper_evidence | WBPaper00006537 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00006537 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |