WormBase Tree Display for Variation: WBVar00091832
expand all nodes | collapse all nodes | view schema
WBVar00091832 | Evidence | Paper_evidence | WBPaper00038207 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok545 | |||||||
Other_name | R08B4.2.1:c.441-123_487-71del | ||||||||
HGVSg | CHROMOSOME_X:g.11123347_11124140del | ||||||||
Sequence_details | SMap | S_parent | Sequence | R08B4 | |||||
Flanking_sequences | cactacgcaagaatatttaaattgtaagct | ctgaattgagaccggaccttggtacttctt | |||||||
Mapping_target | R08B4 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | OK545_external | ||||||||
OK545_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031476 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00044330 | |||||||
WBGene00197137 | |||||||||
Transcript | R08B4.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | R08B4.2.1:c.441-123_487-71del | ||||||||
Intron_number | 4-5/7 | ||||||||
Exon_number | 5/8 | ||||||||
R08B4.7 | VEP_consequence | non_coding_transcript_exon_variant | |||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | 78-? | ||||||||
Exon_number | 1/1 | ||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000456 | Paper_evidence | WBPaper00038207 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The touch insensitivity of alr-1(oy42) mutants could be rescued with a genomic fragment of alr-1 using a mec-3 promoter. | Paper_evidence | WBPaper00038207 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001524 | Paper_evidence | WBPaper00036308 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We investigated a potential redundancy between ceh-17 and the most closely related Prd-like gene in the C_elegans genome, alr-1 (Wormbase WS210). However, the deletion mutation alr-1(ok545) has no effect on ALA-dependent sleep (Table 3)." | Paper_evidence | WBPaper00036308 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003955 | PATO:0000460 | Paper_evidence | WBPaper00036308 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | hs:LIN-3 | Paper_evidence | WBPaper00036308 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Disease_info | Models_disease | DOID:0112038 | |||||||
Models_disease_in_annotation | WBDOannot00000896 | ||||||||
Reference | WBPaper00038207 | ||||||||
WBPaper00036308 | |||||||||
Remark | Last updated on 29 Nov 2002 | ||||||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||||
Method | KO_consortium_allele |