WormBase Tree Display for Variation: WBVar00091978

WBVar00091978 Evidence: Paper_evidence: WBPaper00038275
  Name: Public_name: ok694
    Other_name: ZK470.5a.1:c.249+326_546del
      ZK470.5b.1:c.249+326_546del
    HGVSg: CHROMOSOME_X:g.4150404_4152217del
  Sequence_details: SMap: S_parent: Sequence: ZK470
    Flanking_sequences: tgctgcagctgctgggtttcggttctcaat atgataaggaaacaaaactggaatgttctg
    Mapping_target: ZK470
    Type_of_mutation: Deletion
    PCR_product: ok694_external
      ok694_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00031573
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00006410
    Transcript: ZK470.5b.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: ZK470.5b.1:c.249+326_546del
        cDNA_position: ?-570
        CDS_position: ?-546
        Protein_position: ?-182
        Intron_number: 3-4/8
        Exon_number: 4-5/9
      ZK470.5a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: ZK470.5a.1:c.249+326_546del
        cDNA_position: ?-570
        CDS_position: ?-546
        Protein_position: ?-182
        Intron_number: 3-4/8
        Exon_number: 4-5/9
    Interactor: WBInteraction000501253
      WBInteraction000501254
      WBInteraction000501255
  Isolation: Mutagen: UV/TMP
  Description: Phenotype: WBPhenotype:0000054 Paper_evidence: WBPaper00038275
        Curator_confirmed: WBPerson712
        Remark: Animals and exhibited some larval lethality, 3.6% +/-2.1. Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000120 Paper_evidence: WBPaper00038275
        Curator_confirmed: WBPerson712
        Remark: Immunoblots showed that both NCK-1 protein isoforms are absent, which is consistent with nck-1(ok694) encoding amolecular null. Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000134 Paper_evidence: WBPaper00038275
        Curator_confirmed: WBPerson712
        Remark: The level of nck-1(ok694) RT-PCR produced was approximately 17% of the wild-type level. Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000154 Paper_evidence: WBPaper00038275
        Curator_confirmed: WBPerson712
        Remark: nck-1 animals had a lower brood size than wild-type animals. Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000384 Paper_evidence: WBPaper00038275
        Curator_confirmed: WBPerson712
        Remark: PLM axons overextended towards the anterior. Expressing nck-1A cDNA under the mec-4 promoter, or genomic NCKB, fully rescued the PLM axon overextension defect. | HSN axons inappropriately crossed the ventral midline. Expressing NCK-1A from its own promoter or NCK-1B can partially suppress the HSN midline crossover defect. | In nck-1 mutants, the command interneuron had axons that inappropriately crossed into the left side of the ventral nerve cord. | DD/VD neurons were not significantly affected by the nck-1 mutation. | All six mechanosensory neurons were located in their proper position, and most of the axons migrated in their proper path. Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0006830 PATO:0000460 Paper_evidence: WBPaper00038275
                Curator_confirmed: WBPerson712
            WBbt:0007804 PATO:0000460 Paper_evidence: WBPaper00038275
                Curator_confirmed: WBPerson712
            WBbt:0005490 PATO:0000460 Paper_evidence: WBPaper00038275
                Curator_confirmed: WBPerson712
      WBPhenotype:0000470 Paper_evidence: WBPaper00038275
        Curator_confirmed: WBPerson712
        Remark: nck-1 (ok694) animals had HSN cells that did not migrate at all, or they stopped before reaching their normal position near the vulva. Expression of NCK-1A was unable to rescue the HSN posterior cell body displacement defect. NCK-1B was able to completely rescue the HSN cell migration defect. Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0006830 PATO:0000460 Paper_evidence: WBPaper00038275
                Curator_confirmed: WBPerson712
      WBPhenotype:0000529 Paper_evidence: WBPaper00038275
        Curator_confirmed: WBPerson712
        Remark: The nck-1 mutant animals had excretory canal cells that generally looked wild-type. The only exception was thepresence of a low frequency (5%) of nck-1 mutants that had branched excretory canals. Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005775 PATO:0000460 Paper_evidence: WBPaper00038275
                Curator_confirmed: WBPerson712
            WBbt:0005812 PATO:0000460 Paper_evidence: WBPaper00038275
                Curator_confirmed: WBPerson712
      WBPhenotype:0000843 Paper_evidence: WBPaper00038275
        Curator_confirmed: WBPerson712
        Remark: nck-1(ok694) males do not mate well and had a mating efficiency score of 1 (1=poor mating b1% of wild-type). Only the larger NCK-1A isoform was able to rescue the male mating defects, raising the mating efficiency score from 1 to 4. Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000880 Paper_evidence: WBPaper00038275
        Curator_confirmed: WBPerson712
        Remark: Genetic data showed that the number of PLM axon defects observed in homozygous ok694 was not different from that of ok694 over the deficiency strain syDf1. | In nck-1(ok694)mutants, all six mechanosensory neurons were located in their proper position, and most of the axons migrated in their proper path. The PLM axons, however, overextended towards the anterior. | Two types of HSN defects were observed in nck-1 mutants. Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005490 PATO:0000460 Paper_evidence: WBPaper00038275
                Curator_confirmed: WBPerson712
            WBbt:0006830 PATO:0000460 Paper_evidence: WBPaper00038275
                Curator_confirmed: WBPerson712
      WBPhenotype:0001355 Paper_evidence: WBPaper00038275
        Curator_confirmed: WBPerson712
        Remark: nck-1 mutants had gonads that were significantly narrower thanthe wild-type animals. Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00038275
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005175 PATO:0000460 Paper_evidence: WBPaper00038275
                Curator_confirmed: WBPerson712
  Reference: WBPaper00038275
  Remark: Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele