WormBase Tree Display for Variation: WBVar00091999
expand all nodes | collapse all nodes | view schema
WBVar00091999 | Evidence | Paper_evidence | WBPaper00031945 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok716 | ||||||
Other_name | C07H6.1.1:c.859-17_2029+113del | |||||||
HGVSg | CHROMOSOME_III:g.7522721_7524262del | |||||||
Sequence_details | SMap | S_parent | Sequence | C07H6 | ||||
Flanking_sequences | ttagaaattttttattcgaaaaattgtatc | aagctagagacagtgataaatagtacaagt | ||||||
Mapping_target | C07H6 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok716_external | |||||||
ok716_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023993 | |||||||
WBStrain00031586 | ||||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00002986 | ||||||
Transcript | C07H6.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C07H6.1.1:c.859-17_2029+113del | |||||||
Intron_number | 5-11/12 | |||||||
Exon_number | 6-11/13 | |||||||
Interactor | WBInteraction000521718 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Genetics | Mapping_data | In_multi_point | 4475 | |||||
Description | Phenotype | WBPhenotype:0000164 | Paper_evidence | WBPaper00043908 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000324 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002284 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002295 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002300 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002303 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002309 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002314 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0004022 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0001760 | Paper_evidence | WBPaper00031945 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | MonoG or G-tracts were not deleted at an increased rate as demonstrated by lack of expression of B-galactosidase, which acted as an indicator of a DNA rearrangement bringing a LacZ start codon in-frame with the downstream ORF. No increase in deletion frequency over wild-type was observed for the endogenous qua375 sequence as determined by PCR. At least 24 populations of 5 animals were assayed. | Paper_evidence | WBPaper00031945 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | pkIs2165[pRP1878: hsp-16.41::ATG-(C)23-stops-LacZ unc-119] or pkIs2172 [pRP1889: hsp-16.41::ATG-(monoA)-stops-LacZ unc-119] | Paper_evidence | WBPaper00031945 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00043908 | |||||||
WBPaper00031945 | ||||||||
WBPaper00064961 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |