WormBase Tree Display for Variation: WBVar00092123

WBVar00092123 Evidence: Paper_evidence: WBPaper00040713
  Name: Public_name: ok848
    Other_name: C16C10.5.1:c.226_887+23del
    HGVSg: CHROMOSOME_III:g.4169246_4170642del
  Sequence_details: SMap: S_parent: Sequence: C16C10
    Flanking_sequences: ttgaaaatttttaaagaatttataattaaa agatttaaaatgcttcctcttccaggtgac
    Mapping_target: C16C10
    Type_of_mutation: Deletion
    PCR_product: ok848_external
      ok848_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00031664
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00007626
    Transcript: C16C10.5.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C16C10.5.1:c.226_887+23del
        cDNA_position: 240-?
        CDS_position: 226-?
        Protein_position: 76-?
        Intron_number: 3-8/9
        Exon_number: 3-8/10
    Interactor: WBInteraction000504343
      WBInteraction000504344
      WBInteraction000519469
  Isolation: Mutagen: UV/TMP
  Description: Phenotype: WBPhenotype:0000195 Paper_evidence: WBPaper00040713
        Curator_confirmed: WBPerson712
        Remark: Animals have low penetrance, but reproducible defects in the migration of the posterior DTC. Paper_evidence: WBPaper00040713
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00040713
          Curator_confirmed: WBPerson712
      WBPhenotype:0001236 Paper_evidence: WBPaper00036076
        Curator_confirmed: WBPerson2987
        Remark: "Higher hsp-4 : : gfp levels were also observed in the rnf-121 ( ok848 ) mutant worms ( Supplemental Figure S2 ) . This increase in hsp-4 : : gfp expression demonstrated that reducing the level of RNF-121 causes UPR activation . " Paper_evidence: WBPaper00036076
            Curator_confirmed: WBPerson2987
          "In accordance , massive accumulation of inclusions and high GFP levels were detected in PAT-3 : : GFP ; rnf-121 ( ok848 ) mutant larvae ( Figure 5F ) ." Paper_evidence: WBPaper00036076
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: hsp-4 : : gfp Paper_evidence: WBPaper00036076
              Curator_confirmed: WBPerson2987
            PAT-3 : : GFP Paper_evidence: WBPaper00036076
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001719 Paper_evidence: WBPaper00036076
        Curator_confirmed: WBPerson2987
        Remark: "Higher hsp-4 : : gfp levels were also observed in the rnf-121 ( ok848 ) mutant worms ( Supplemental Figure S2 ) . This increase in hsp-4 : : gfp expression demonstrated that reducing the level of RNF-121 causes UPR activation . " Paper_evidence: WBPaper00036076
            Curator_confirmed: WBPerson2987
      WBPhenotype:0001724 Paper_evidence: WBPaper00036076
        Curator_confirmed: WBPerson2987
        Remark: "To test the possible role of RNF-121 in the cellular response to ER stress , we compared the growth of wild-type ( N2 ) and rnf-121 ( ok848 ) mutant worms in a medium containing tunicamycin, an inhibitor of N-glycosylation . At 2 μg/ml tunicamycin 67.6 15.2% of the mutant rnf-121 ( ok848 ) worms were arrested at or before the L3 stage , whereas only 22.4 16.5% of N2 ( wild-type ) animals were arrested ( Figure 2A , yellow bar ) . At 5 μg/ml tunicamycin , we observed major growth arrest and larval lethality in both N2 and rnf-121 ( ok848 ) worms ." Paper_evidence: WBPaper00036076
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00004565 Paper_evidence: WBPaper00036076
              Curator_confirmed: WBPerson2987
    Phenotype_not_observed: WBPhenotype:0000062 Paper_evidence: WBPaper00040713
        Curator_confirmed: WBPerson712
        Remark: Animals are viable. Paper_evidence: WBPaper00040713
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00040713
          Curator_confirmed: WBPerson712
      WBPhenotype:0000518 Paper_evidence: WBPaper00036076
        Curator_confirmed: WBPerson2987
        Remark: "rnf-121 ( ok848 ) mutant worms ( isolated by the C . elegans Gene Knockout Consortium ) develop normally and are fertile ." Paper_evidence: WBPaper00036076
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000688 Paper_evidence: WBPaper00040713
          WBPaper00036076
        Curator_confirmed: WBPerson712
          WBPerson2987
        Remark: Animals are fertile. Paper_evidence: WBPaper00040713
            Curator_confirmed: WBPerson712
          "rnf-121 ( ok848 ) mutant worms ( isolated by the C . elegans Gene Knockout Consortium ) develop normally and are fertile ." Paper_evidence: WBPaper00036076
            Curator_confirmed: WBPerson2987
        Recessive: Paper_evidence: WBPaper00040713
          Curator_confirmed: WBPerson712
  Reference: WBPaper00040713
    WBPaper00036076
  Remark: Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele