WormBase Tree Display for Variation: WBVar00092291
expand all nodes | collapse all nodes | view schema
WBVar00092291 | Name | Public_name | ok1021 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE30881:p.Glu93ArgfsTer4 | ||||||||
C26D10.5b.1:c.277_1532del | |||||||||
CE03028:p.Glu93ArgfsTer4 | |||||||||
C26D10.5a.1:c.277_1532del | |||||||||
HGVSg | CHROMOSOME_II:g.8347098_8348601del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C26D10 | |||||
Flanking_sequences | caactcgcatcccaagagatcaatgatgat | cgatcttgttgagggaaaatggcacgaaat | |||||||
Mapping_target | C26D10 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok1021_external | ||||||||
ok1021_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00003879 | ||||||||
WBStrain00003886 | |||||||||
WBStrain00036059 | |||||||||
WBStrain00040722 | |||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001159 | |||||||
Transcript | C26D10.5a.1 (11) | ||||||||
C26D10.5b.1 (11) | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000702 | Paper_evidence | WBPaper00031953 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No hyp8-hyp11 cell fusion was observed in males, as assayed by the persistence into adulthood of cell boundaries (visualized by AJM::GFP). | Paper_evidence | WBPaper00031953 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004381 | PATO:0000460 | Paper_evidence | WBPaper00031953 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004380 | PATO:0000460 | Paper_evidence | WBPaper00031953 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004378 | PATO:0000460 | Paper_evidence | WBPaper00031953 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004377 | PATO:0000460 | Paper_evidence | WBPaper00031953 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000073 | PATO:0000460 | Paper_evidence | WBPaper00031953 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | syIs78[AJM-1::GFP, unc-119(+)] | Paper_evidence | WBPaper00031953 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002365 | Paper_evidence | WBPaper00046306 | |||||||
Curator_confirmed | WBPerson9270 | ||||||||
Remark | Table S1 | Paper_evidence | WBPaper00046306 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
Phenotype_not_observed | WBPhenotype:0000070 | Paper_evidence | WBPaper00031953 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Tail retraction proceeded with only subtle abnormalities resulting in a blunt-ended tail. | Paper_evidence | WBPaper00031953 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00031953 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | syIs78[AJM-1::GFP, unc-119(+)] | Paper_evidence | WBPaper00031953 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000702 | Paper_evidence | WBPaper00029363 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Does not affect cell fusion in the anchor cell, specific vulval and late seam cells | Paper_evidence | WBPaper00029363 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00029363 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00029363 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001431 | Paper_evidence | WBPaper00031953 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Tail retraction proceeded with only subtle abnormalities. | Paper_evidence | WBPaper00031953 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000073 | PATO:0000460 | Paper_evidence | WBPaper00031953 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | syIs78[AJM-1::GFP, unc-119(+)] | Paper_evidence | WBPaper00031953 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001911 | Paper_evidence | WBPaper00046306 | |||||||
Curator_confirmed | WBPerson9270 | ||||||||
Remark | Table S2 | Paper_evidence | WBPaper00046306 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
WBPhenotype:0002478 | Paper_evidence | WBPaper00053323 | |||||||
Curator_confirmed | WBPerson9270 | ||||||||
Remark | Figure 5, level of phosphatidylserine exposed on the PLM axon after axotomy unchanged compared to wild type | Paper_evidence | WBPaper00053323 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00053323 | ||||
Curator_confirmed | WBPerson9270 | ||||||||
GO_term | GO:0030424 | PATO:0000460 | Paper_evidence | WBPaper00053323 | |||||
Curator_confirmed | WBPerson9270 | ||||||||
Molecule_affected | WBMol:00003183 | PATO:0000460 | Paper_evidence | WBPaper00053323 | |||||
Curator_confirmed | WBPerson9270 | ||||||||
Reference | WBPaper00031953 | ||||||||
WBPaper00029363 | |||||||||
WBPaper00046306 | |||||||||
WBPaper00053323 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |