WormBase Tree Display for Variation: WBVar00092312
expand all nodes | collapse all nodes | view schema
WBVar00092312 | Name | Public_name | ok1042 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | W04C9.1a.1:c.635_1725+8del | |||||||
W04C9.1b.1:c.437_1527+8del | ||||||||
HGVSg | CHROMOSOME_I:g.491887_493564del | |||||||
Sequence_details | SMap | S_parent | Sequence | W04C9 | ||||
Flanking_sequences | acacgggacaagtcatcgctaccgtggtcg | gcgtcaatttcggttcgacaaatcgtttgc | ||||||
Mapping_target | W04C9 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK1042_external | |||||||
OK1042_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031784 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00001814 | ||||||
Transcript | W04C9.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | W04C9.1b.1:c.437_1527+8del | |||||||
cDNA_position | 437-? | |||||||
CDS_position | 437-? | |||||||
Protein_position | 146-? | |||||||
Intron_number | 4-6/8 | |||||||
Exon_number | 4-6/9 | |||||||
W04C9.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | W04C9.1a.1:c.635_1725+8del | |||||||
cDNA_position | 717-? | |||||||
CDS_position | 635-? | |||||||
Protein_position | 212-? | |||||||
Intron_number | 6-8/11 | |||||||
Exon_number | 6-8/12 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype | WBPhenotype:0000031 | Paper_evidence | WBPaper00033097 | ||||
Curator_confirmed | WBPerson10361 | |||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00033097 | ||||||
Curator_confirmed | WBPerson10361 | |||||||
WBPhenotype:0000208 | Paper_evidence | WBPaper00033097 | ||||||
Curator_confirmed | WBPerson10361 | |||||||
Phenotype_not_observed | WBPhenotype:0000634 | Paper_evidence | WBPaper00033097 | |||||
Curator_confirmed | WBPerson10361 | |||||||
WBPhenotype:0001208 | Paper_evidence | WBPaper00027644 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Animals were not resistant to RNAi as assayed on either pop-1 RNAi or unc-22 RNAi. | Paper_evidence | WBPaper00027644 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Animals reared on both pop-1 and unc-22 feeding plates at 15, 20, 25, and 26C. | Paper_evidence | WBPaper00027644 | ||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00027644 | |||||||
WBPaper00033097 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |