WormBase Tree Display for Variation: WBVar00092591
expand all nodes | collapse all nodes | view schema
WBVar00092591 | Evidence | Paper_evidence | WBPaper00031859 | |||||
---|---|---|---|---|---|---|---|---|
Person_evidence | WBPerson59652 | |||||||
Name | Public_name | ok1372 | ||||||
Other_name | C30A5.2.1:c.53_*3+391del | |||||||
Rearrangement | ||||||||
HGVSg | CHROMOSOME_III:g.8226554_8227823del | |||||||
Sequence_details | SMap | S_parent | Sequence | C02F5 | ||||
Flanking_sequences | tcaaatacgaaactgcctacgatcttctgg | tcgtcgttgcccatttcgccgtgtggaaga | ||||||
Mapping_target | C30A5 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK1372_external | |||||||
OK1372_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031979 | |||||||
WBStrain00048305 | ||||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004342 | ||||||
Transcript | C30A5.2.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | 77-? | |||||||
CDS_position | 53-? | |||||||
Protein_position | 18-? | |||||||
Intron_number | 2-4/5 | |||||||
Exon_number | 2-6/6 | |||||||
C30A5.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C30A5.2.1:c.53_*3+391del | |||||||
cDNA_position | 77-? | |||||||
CDS_position | 53-? | |||||||
Protein_position | 18-? | |||||||
Intron_number | 2-6/6 | |||||||
Exon_number | 2-6/7 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Genetics | Interpolated_map_position | III | -0.356853 | |||||
Mapping_data | In_multi_point | 4934 | ||||||
Description | Phenotype | WBPhenotype:0000000 | Paper_evidence | WBPaper00031859 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Prior to the onset of sterility, greater than 95% of animals exhibited chromatin bridges, large agglomerates of genetic material in developing eggs and aberrant numbers of DAPI staining bodies at diakinesis. In stabilized lines, where sterility was not observed, DAPI staining bodies were also aberrant in number and size suggestive of the presence of chromosome fragments and chromosome fusions. | Paper_evidence | WBPaper00031859 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000145 | Paper_evidence | WBPaper00031859 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Populations exhibited fluctuations in brood size from generation to generation. Lines were shown to transition rapidly from fully fertile to sterile, while others showed a slow decline, remaining sub-fertile for many generations. In some cases transitions would occur from low to high to low fecundity, showing a 'rescue' in fecundity. | Paper_evidence | WBPaper00031859 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000879 | Paper_evidence | WBPaper00031859 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Telomeres appeared slightly longer than in wild-type, as assayed by Southern blot, although they were observed to experience a shortening of ~75 bp per generation compared to no shortening in wild-type animals. Loss of telomere length occurred well before loss of fecundity. | Paper_evidence | WBPaper00031859 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00031859 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000894 | Paper_evidence | WBPaper00031859 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Prior to the onset of sterility, although the germlines are usually full of eggs and sperm, 15% of animals exhibited aberrantly sized sperm, prematurely cellularized nuclei, decreased numbers of pachytene nuclei, and in rare animals (5%), a complete loss of germline nuclei. In addition, accumulation of unlaid eggs were seen. | Paper_evidence | WBPaper00031859 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000966 | Paper_evidence | WBPaper00031859 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Fecundity dropped (brood sizes decreased and sterile animals arose) as animals were serially passaged (sterility was reached after 20 generations) . The Mrt phenotype was attenuated by passaging in the presence of excess food, although sterility was still observed in the population within 16 generations. | Paper_evidence | WBPaper00031859 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were grown for 1 week on a small agar plate with a lawn of E. coli OP50 as food, experiencing starvation in between passages. | Paper_evidence | WBPaper00031859 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00031859 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Male production (2.2%) was increased compared to N2 (0.06%). | Paper_evidence | WBPaper00031859 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001388 | Paper_evidence | WBPaper00031859 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit a significantly reduced hatching rate compared to N2 animals after exposure to ionizing radiation. | Paper_evidence | WBPaper00031859 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were treated with increasing doses of IR. | Paper_evidence | WBPaper00031859 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00031859 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Hatch rate is not severely decreased compared to N2. | Paper_evidence | WBPaper00031859 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000228 | Paper_evidence | WBPaper00031859 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Dpy, Unc, Rol animals that cropped up in later generations, did not breed true and were deemed likely to be due to somatic mutation or transient genome instability rather than germline changes. | Paper_evidence | WBPaper00031859 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001222 | Paper_evidence | WBPaper00031859 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No difference was observed in reversion rate of unc-58(e665) compared to wild type. | Paper_evidence | WBPaper00031859 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | unc-58(e665) | Paper_evidence | WBPaper00031859 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001795 | Paper_evidence | WBPaper00031859 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Repeat lengths from three microsatellite loci showed no changes from generation to generation. | Paper_evidence | WBPaper00031859 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00031859 | |||||||
WBPaper00060301 | ||||||||
Remark | [210303 skd] Primers and PCR conditions for genotyping are provided in Table S5 in WBPaper00060301 | Paper_evidence | WBPaper00060301 | |||||
Curator_confirmed | WBPerson51134 | |||||||
Sanger sequencing data is available upon request if needed for independent verification | Person_evidence | WBPerson59652 | ||||||
Curator_confirmed | WBPerson51134 | |||||||
alt_det = 1270 bp deletion, which starts in the middle of exon 1 and removes all other exons. | Person_evidence | WBPerson59652 | ||||||
Curator_confirmed | WBPerson51134 | |||||||
Variation information submitted by WBPerson59652 on 2023-08-3_11:10:07 via the Allele submission form. | Curator_confirmed | WBPerson51134 | ||||||
Method | Deletion_allele |