WormBase Tree Display for Variation: WBVar00092734
expand all nodes | collapse all nodes | view schema
WBVar00092734 | Evidence | Paper_evidence | WBPaper00041203 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok1523 | |||||||
Other_name | F41G4.2a.1:c.-22_2469del | ||||||||
F41G4.2b.1:c.118+1598_369del | |||||||||
HGVSg | CHROMOSOME_X:g.16809210_16811938del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F41G4 | |||||
Flanking_sequences | cgtgtccttgaaattgttgatttcaccaag | gagaaataaaattgcaatgcaaaaaaaaaa | |||||||
Mapping_target | F41G4 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok1523_external | ||||||||
ok1523_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00036361 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000294 | |||||||
Transcript | F41G4.2b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F41G4.2b.1:c.118+1598_369del | ||||||||
cDNA_position | ?-372 | ||||||||
CDS_position | ?-369 | ||||||||
Protein_position | ?-123 | ||||||||
Intron_number | 2-3/8 | ||||||||
Exon_number | 3-4/9 | ||||||||
F41G4.2a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,start_lost,5_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F41G4.2a.1:c.-22_2469del | ||||||||
cDNA_position | 771-3261 | ||||||||
CDS_position | ?-2469 | ||||||||
Protein_position | ?-823 | ||||||||
Intron_number | 2-3/8 | ||||||||
Exon_number | 1-4/9 | ||||||||
Interactor | WBInteraction000518632 | ||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000059 | Paper_evidence | WBPaper00041203 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Most homozygotes were arrested at variable larval stages and became immobile. Heterozygotes were indistinguishable from wild-type. | Paper_evidence | WBPaper00041203 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00041203 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00041203 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00041203 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | UNC-60B subcellular localization was significantly altered in muscle; diffuse localization of UNC-60B was diminished, and UNC-60B was concentrated into aggregates where actin was also accumulated. | Paper_evidence | WBPaper00041203 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00041203 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00041203 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00041203 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00041203 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The few escapers became adults but failed to reproduce. | Paper_evidence | WBPaper00041203 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00041203 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00041203 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001587 | Paper_evidence | WBPaper00041203 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Phalloidin staining showed that sarcomeric actin filaments in the body wall muscle of arrested larvae and escaper adults were severely disorganized with formation of a number of F-actin aggregates. Abnormalities of actin filament organization were also detected in embryonic muscle. Abnormalities of F-actin organization in other tissues was not detected. | Paper_evidence | WBPaper00041203 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00041203 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00041203 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00041203 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00041203 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00041203 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00041203 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
GO_term | GO:0005884 | PATO:0000937 | Paper_evidence | WBPaper00041203 | |||||
Curator_confirmed | WBPerson712 | ||||||||
GO:0030017 | PATO:0000937 | Paper_evidence | WBPaper00041203 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00041203 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |